2024-04-25 04:47:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_133514 1714 bp mRNA linear ROD 20-NOV-2023 DEFINITION Rattus norvegicus matrix metallopeptidase 10 (Mmp10), mRNA. ACCESSION NM_133514 VERSION NM_133514.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1714) AUTHORS Faraj Shaglouf LH, Ranjpour M, Wajid S and Jain SK. TITLE Elevated expression of cellular SYNE1, MMP10, and GTPase1 and their regulatory role in hepatocellular carcinoma progression JOURNAL Protoplasma 257 (1), 157-167 (2020) PUBMED 31428857 REMARK GeneRIF: Elevated expression of cellular SYNE1, MMP10, and GTPase1 and their regulatory role in hepatocellular carcinoma progression. REFERENCE 2 (bases 1 to 1714) AUTHORS Takamura Y, Matsumoto T, Tomomatsu T, Matsumura T, Takihara Y and Inatani M. TITLE Aldose reductase inhibitor counteracts the enhanced expression of matrix metalloproteinase-10 and improves corneal wound healing in galactose-fed rats JOURNAL Mol Vis 19, 2477-2486 (2013) PUBMED 24339723 REMARK GeneRIF: MMP-10 modulates corneal epithelial wound healing. Publication Status: Online-Only REFERENCE 3 (bases 1 to 1714) AUTHORS Thibert KA, Raymond GV, Nascene DR, Miller WP, Tolar J, Orchard PJ and Lund TC. TITLE Cerebrospinal fluid matrix metalloproteinases are elevated in cerebral adrenoleukodystrophy and correlate with MRI severity and neurologic dysfunction JOURNAL PLoS One 7 (11), e50430 (2012) PUBMED 23185624 REFERENCE 4 (bases 1 to 1714) AUTHORS Friese RS, Rao F, Khandrika S, Thomas B, Ziegler MG, Schmid-Schonbein GW and O'Connor DT. TITLE Matrix metalloproteinases: discrete elevations in essential hypertension and hypertensive end-stage renal disease JOURNAL Clin Exp Hypertens 31 (7), 521-533 (2009) PUBMED 19886850 REFERENCE 5 (bases 1 to 1714) AUTHORS Nishino K, Yamanouchi K, Naito K and Tojo H. TITLE Matrix metalloproteinases regulate mesonephric cell migration in developing XY gonads which correlates with the inhibition of tissue inhibitor of metalloproteinase-3 by Sry JOURNAL Dev Growth Differ 44 (1), 35-43 (2002) PUBMED 11869290 REFERENCE 6 (bases 1 to 1714) AUTHORS Saghizadeh M, Brown DJ, Castellon R, Chwa M, Huang GH, Ljubimova JY, Rosenberg S, Spirin KS, Stolitenko RB, Adachi W, Kinoshita S, Murphy G, Windsor LJ, Kenney MC and Ljubimov AV. TITLE Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic corneas: a possible mechanism of basement membrane and integrin alterations JOURNAL Am J Pathol 158 (2), 723-734 (2001) PUBMED 11159210 REFERENCE 7 (bases 1 to 1714) AUTHORS Chan JC, Scanlon M, Zhang HZ, Jia LB, Yu DH, Hung MC, French M and Eastman EM. TITLE Molecular cloning and characterization of v-mos-activated transformation-associated proteins JOURNAL J Biol Chem 267 (2), 1099-1103 (1992) PUBMED 1370458 REFERENCE 8 (bases 1 to 1714) AUTHORS De Vouge MW and Mukherjee BB. TITLE Transformation of normal rat kidney cells by v-K-ras enhances expression of transin 2 and an S-100-related calcium-binding protein JOURNAL Oncogene 7 (1), 109-119 (1992) PUBMED 1741158 REFERENCE 9 (bases 1 to 1714) AUTHORS Breathnach,R., Matrisian,L.M., Gesnel,M.C., Staub,A. and Leroy,P. TITLE Sequences coding for part of oncogene-induced transin are highly conserved in a related rat gene JOURNAL Nucleic Acids Res 15 (3), 1139-1151 (1987) PUBMED 3547333 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000188.1. On Nov 24, 2020 this sequence version replaced NM_133514.1. ##Evidence-Data-START## Transcript exon combination :: X05083.1, M65253.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMD00132261, SAMD00132265 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-139 JACYVU010000188.1 4689840-4689978 140-384 JACYVU010000188.1 4690615-4690859 385-533 JACYVU010000188.1 4690951-4691099 534-659 JACYVU010000188.1 4691540-4691665 660-824 JACYVU010000188.1 4692800-4692964 825-966 JACYVU010000188.1 4693512-4693653 967-1100 JACYVU010000188.1 4694453-4694586 1101-1260 JACYVU010000188.1 4695259-4695418 1261-1364 JACYVU010000188.1 4696091-4696194 1365-1714 JACYVU010000188.1 4697399-4697748 FEATURES Location/Qualifiers source 1..1714 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="8" /map="8q11" gene 1..1714 /gene="Mmp10" /gene_synonym="SL-2" /note="matrix metallopeptidase 10" /db_xref="GeneID:117061" /db_xref="RGD:620192" exon 1..139 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" misc_feature 5..7 /gene="Mmp10" /gene_synonym="SL-2" /note="upstream in-frame stop codon" CDS 35..1465 /gene="Mmp10" /gene_synonym="SL-2" /EC_number="3.4.24.22" /note="stromelysin-2; transin-2; matrix metalloproteinase-10; transformation-associated protein 34A" /codon_start=1 /product="stromelysin-2 precursor" /protein_id="NP_598198.2" /db_xref="GeneID:117061" /db_xref="RGD:620192" /translation="
MEPLAILVLLCFPICSAYPLHGAVRQDHSTMDLAQQYLEKYYNFRKNEKQFFKRKDSSPVVKKIEEMQKFLGLEMTGKLDSNTVEMMHKPRCGVPDVGGFSTFPGSPKWRKNHISYRIVNYTLDLPRESVDSAIERALKVWEEVTPLTFSRISEGEADIMISFAVGEHGDFYPFDGVGQSLAHAYPPGPGFYGDAHFDDDEKWSLGPSGTNLFLVAAHELGHSLGLFHSNNKESLMYPVYRFSTSQANIRLSQDDIEGIQSLYGARPSSDATVVPVPSVSPKPETPVKCDPALSFDAVTMLRGEFLFFKDRHFWRRTQWNPEPEFHLISAFWPSLPSGLDAAYEANNKDRVLIFKGSQFWAVRGNEVQAGYPKRIHTLGFPPTVKKIDAAVFEKEKKKTYFFVGDKYWRFDETRQLMDKGFPRLITDDFPGIEPQVDAVLHAFGFFYFFRGSSQFEFDPNARTVTHTLKSNSWLLC"
sig_peptide 35..85 /gene="Mmp10" /gene_synonym="SL-2" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 131..295 /gene="Mmp10" /gene_synonym="SL-2" /note="Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471" /db_xref="CDD:426277" misc_feature 302..325 /gene="Mmp10" /gene_synonym="SL-2" /note="propagated from UniProtKB/Swiss-Prot (P07152.1); Region: Cysteine switch. /evidence=ECO:0000250" mat_peptide 332..1462 /gene="Mmp10" /gene_synonym="SL-2" /product="Stromelysin-2. /id=PRO_0000028769" /note="propagated from UniProtKB/Swiss-Prot (P07152.1)" misc_feature 356..826 /gene="Mmp10" /gene_synonym="SL-2" /note="Matrixin; Region: Peptidase_M10; pfam00413" /db_xref="CDD:425668" misc_feature 890..1462 /gene="Mmp10" /gene_synonym="SL-2" /note="Hemopexin-like repeats.; Hemopexin is a heme-binding protein that transports heme to the liver. Hemopexin-like repeats occur in vitronectin and some matrix metalloproteinases family (matrixins). The HX repeats of some matrixins bind tissue inhibitor of...; Region: HX; cd00094" /db_xref="CDD:238046" misc_feature 890..1039 /gene="Mmp10" /gene_synonym="SL-2" /note="propagated from UniProtKB/Swiss-Prot (P07152.1); Region: Hemopexin 1" misc_feature order(920..922,926..928,1052..1054,1058..1060,1196..1198, 1202..1204,1343..1345,1349..1351) /gene="Mmp10" /gene_synonym="SL-2" /note="Metal binding sites [ion binding]; metal-binding site" /db_xref="CDD:238046" misc_feature 1040..1180 /gene="Mmp10" /gene_synonym="SL-2" /note="propagated from UniProtKB/Swiss-Prot (P07152.1); Region: Hemopexin 2" misc_feature 1184..1330 /gene="Mmp10" /gene_synonym="SL-2" /note="propagated from UniProtKB/Swiss-Prot (P07152.1); Region: Hemopexin 3" misc_feature 1331..1462 /gene="Mmp10" /gene_synonym="SL-2" /note="propagated from UniProtKB/Swiss-Prot (P07152.1); Region: Hemopexin 4" exon 140..384 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 385..533 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 534..659 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 660..824 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 825..966 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 967..1100 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 1101..1260 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 1261..1364 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" exon 1365..1714 /gene="Mmp10" /gene_synonym="SL-2" /inference="alignment:Splign:2.1.0" ORIGIN
aagttaggtgctacagaaggtaaaggctgtctctatggagccactggccatcctggtgctgctgtgctttccgatctgctcagcatatcctctgcatggggcagtgagacaagaccactcaaccatggatcttgctcagcaatacctagaaaaatactacaactttagaaaaaatgagaaacaatttttcaaaagaaaggacagtagtcctgttgtcaaaaaaattgaagaaatgcagaagttccttgggctggagatgacagggaagctggactcgaacactgtggagatgatgcacaagccccggtgtggtgttcccgacgtcggtggcttcagtacctttccaggttcacccaaatggaggaaaaaccacatctcctacaggattgtgaattatacactggatttaccaagagagagtgtggattctgccattgagagagctttgaaggtctgggaggaggtgaccccactcacattctccaggatctctgaaggagaggctgacataatgatctcctttgcagttggagaacatggagacttttacccttttgatggagtgggacagagcttggctcatgcctacccacctggccctggattttatggagatgctcacttcgatgatgatgagaaatggtcactgggaccctcagggaccaatttattcctggttgctgcgcatgaacttggtcactccctgggtctctttcactcaaacaacaaagaatctctgatgtacccagtctacaggttctccacgagccaagccaacattcgcctttctcaggatgatatagagggcattcaatccctgtatggagcccgcccctcctctgatgccacagtggttcctgtgccctctgtctctccaaaacctgagaccccagtcaaatgtgatcctgctttgtcctttgatgcagtcaccatgctgagaggggaattcctattctttaaagacaggcacttctggcgtagaacccagtggaatcccgagcctgaattccatttgatttcagcattttggccctctcttccttcaggcttagatgctgcctatgaggcaaataacaaggacagagttctgatttttaaaggaagtcagttctgggcagtccgaggaaatgaagtccaagcaggttacccaaagaggatccacactcttggctttcctcccaccgtgaagaagattgatgcagctgtttttgaaaaggagaagaagaagacgtatttctttgtaggtgacaaatactggagatttgatgagacaagacagcttatggataaaggcttcccgagactgataacagatgacttcccaggaattgagccacaagttgatgctgtgttacatgcatttgggtttttttatttcttccgtggatcatcacagttcgagtttgaccccaatgccaggacggtgacacacacactgaagagcaacagctggctgttgtgctgattatcatgatgacaagacatatacaacactgtaaaatagtatttctcgcctaatttattatgtgtcataatgatgaattgttcctgcatgtgctgtggctcgagatgagcccagcagatagatgtctttcttaatgaaccacagagcatcacctgagcacagaagtgaaagcttctcggtacactaggtgagaggatgcatccccatgggtactttattgtttaataaagaactttatttttgaaccat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]