LOCUS       NM_053241               1173 bp    mRNA    linear   ROD 26-SEP-2023
DEFINITION  Mus musculus claudin 16 (Cldn16), mRNA.
ACCESSION   NM_053241
VERSION     NM_053241.5
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1173)
  AUTHORS   Paes MF, Zipinotti Dos Santos D, Massariol Pimenta T, Ribeiro
            Junior RS, da Silva Martins B, Greco SJ, Carvalho AA, Bacchi C,
            Duarte C, Carvalho I, Silva IV and Azevedo Rangel LB.
  TITLE     Overexpression of CLDN16 in ovarian cancer is modulated by PI3K and
            PKC pathways
  JOURNAL   Exp Cell Res 426 (2), 113523 (2023)
   PUBMED   36889572
  REMARK    GeneRIF: Overexpression of CLDN16 in ovarian cancer is modulated by
            PI3K and PKC pathways.
REFERENCE   2  (bases 1 to 1173)
  AUTHORS   Higashi AY, Higashi T, Furuse K, Ozeki K, Furuse M and Chiba H.
  TITLE     Claudin-9 constitutes tight junctions of folliculo-stellate cells
            in the anterior pituitary gland
  JOURNAL   Sci Rep 11 (1), 21642 (2021)
   PUBMED   34737342
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1173)
  AUTHORS   Ingham NJ, Pearson SA, Vancollie VE, Rook V, Lewis MA, Chen J,
            Buniello A, Martelletti E, Preite L, Lam CC, Weiss FD, Powis Z,
            Suwannarat P, Lelliott CJ, Dawson SJ, White JK and Steel KP.
  TITLE     Mouse screen reveals multiple new genes underlying mouse and human
            hearing loss
  JOURNAL   PLoS Biol 17 (4), e3000194 (2019)
   PUBMED   30973865
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1173)
  AUTHORS   Breiderhoff T, Himmerkus N, Drewell H, Plain A, Gunzel D, Mutig K,
            Willnow TE, Muller D and Bleich M.
  TITLE     Deletion of claudin-10 rescues claudin-16-deficient mice from
            hypomagnesemia and hypercalciuria
  JOURNAL   Kidney Int 93 (3), 580-588 (2018)
   PUBMED   29129401
  REMARK    GeneRIF: Severe individual renal phenotypes in claudin-10 and
            claudin-16 knockout mice are corrected by the additional deletion
            of the other claudin.
REFERENCE   5  (bases 1 to 1173)
  AUTHORS   Milatz S, Himmerkus N, Wulfmeyer VC, Drewell H, Mutig K, Hou J,
            Breiderhoff T, Muller D, Fromm M, Bleich M and Gunzel D.
  TITLE     Mosaic expression of claudins in thick ascending limbs of Henle
            results in spatial separation of paracellular Na+ and Mg2+
            transport
  JOURNAL   Proc Natl Acad Sci U S A 114 (2), E219-E227 (2017)
   PUBMED   28028216
REFERENCE   6  (bases 1 to 1173)
  AUTHORS   Hou J, Shan Q, Wang T, Gomes AS, Yan Q, Paul DL, Bleich M and
            Goodenough DA.
  TITLE     Transgenic RNAi depletion of claudin-16 and the renal handling of
            magnesium
  JOURNAL   J Biol Chem 282 (23), 17114-17122 (2007)
   PUBMED   17442678
  REMARK    GeneRIF: data suggest that claudin-16 forms a non-selective
            paracellular cation channel, rather than a selective Mg(2+)/Ca(2+)
            channel as previously proposed
REFERENCE   7  (bases 1 to 1173)
  AUTHORS   Konrad M, Schaller A, Seelow D, Pandey AV, Waldegger S, Lesslauer
            A, Vitzthum H, Suzuki Y, Luk JM, Becker C, Schlingmann KP, Schmid
            M, Rodriguez-Soriano J, Ariceta G, Cano F, Enriquez R, Juppner H,
            Bakkaloglu SA, Hediger MA, Gallati S, Neuhauss SC, Nurnberg P and
            Weber S.
  TITLE     Mutations in the tight-junction gene claudin 19 (CLDN19) are
            associated with renal magnesium wasting, renal failure, and severe
            ocular involvement
  JOURNAL   Am J Hum Genet 79 (5), 949-957 (2006)
   PUBMED   17033971
REFERENCE   8  (bases 1 to 1173)
  AUTHORS   Ohta H, Adachi H and Inaba M.
  TITLE     Developmental changes in the expression of tight junction protein
            claudins in murine metanephroi and embryonic kidneys
  JOURNAL   J Vet Med Sci 68 (2), 149-155 (2006)
   PUBMED   16520537
REFERENCE   9  (bases 1 to 1173)
  AUTHORS   Hou J, Paul DL and Goodenough DA.
  TITLE     Paracellin-1 and the modulation of ion selectivity of tight
            junctions
  JOURNAL   J Cell Sci 118 (Pt 21), 5109-5118 (2005)
   PUBMED   16234325
REFERENCE   10 (bases 1 to 1173)
  AUTHORS   Weber S, Schlingmann KP, Peters M, Nejsum LN, Nielsen S, Engel H,
            Grzeschik KH, Seyberth HW, Grone HJ, Nusing R and Konrad M.
  TITLE     Primary gene structure and expression studies of rodent
            paracellin-1
  JOURNAL   J Am Soc Nephrol 12 (12), 2664-2672 (2001)
   PUBMED   11729235
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK085268.1 and AK085333.1.
            
            On Aug 11, 2010 this sequence version replaced NM_053241.4.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. The protein encoded by this gene is critical
            for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in
            the thick ascending loop of Henle. The gene deficiency leads to
            specific alterations in renal Ca(2+) and Mg(2+) balance and also to
            disturbances in Na(+) handling. The interaction of this gene and
            the Cldn 19 gene is required for their assembly into tight
            junctions and for renal Mg(2+) reabsorption. This gene and the
            Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug
            2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK085333.1, AK085268.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849385 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1149              AK085268.1         2-1150
            1150-1173           AK085333.1         1126-1149
FEATURES             Location/Qualifiers
     source          1..1173
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="16"
                     /map="16 18.1 cM"
     gene            1..1173
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="claudin 16"
                     /db_xref="GeneID:114141"
                     /db_xref="MGI:MGI:2148742"
     exon            1..465
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    259..261
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="upstream in-frame stop codon"
     CDS             352..1059
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="H59D2a protein; paracellin-1"
                     /codon_start=1
                     /product="claudin-16"
                     /protein_id="NP_444471.1"
                     /db_xref="CCDS:CCDS28088.1"
                     /db_xref="GeneID:114141"
                     /db_xref="MGI:MGI:2148742"
                     /translation="

MKDLLQYAACFLAIFSTGFLIVATWTDCWMVNADDSLEVSTKCRGLWWECVTNAFDGIRTCDEYDSIYAEHPLKLVVTRALMITADILAGFGFITLLLGLDCVKFLPDDPQIKVRLCFVAGTTLLIAGTPGIIGSVWYAVDVYVERSSLVLHNIFLGIQYKFGWSCWLGMAGSLGCFLAGALLTCCLYLFKDVGPERNYPYAMRKPYSTAGVSMAKSYKAPRTETAKMYAVDTRV"

     misc_feature    361..423
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    382..900
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:451326"
     misc_feature    589..651
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    697..759
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    859..921
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     exon            466..568
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            569..733
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            734..925
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            926..1173
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cacaggcctctgtgactatcatttcacattagcccacagccaaggctgcttctgccacgaaccaggatgtgcccgggtcttcccctgccctggcttctgattgggagcctggccgctggatagtgacctccacgaccctcgctctggaacaacctgtttatacaattctttctgaagcctaaagtgcctgcaagagggatgtgaggaaacgtgaaagactgggcactatcatccccaggtaccggcgacagagaccaatagcaacagaggcccatagcatcagaagccaatagcattccagctgaactggcatctgcccatgtgtcccttcccaacaggctgtttgctgccatgaaggatcttcttcagtacgctgcctgcttcttggccatattctccactgggtttttgatcgtggccacctggacagactgttggatggtgaacgctgatgactccctggaggtgagcactaaatgcagaggcctgtggtgggagtgtgtaacaaacgcttttgatgggattcgaacctgcgatgagtacgactccatatatgcagaacatcccttgaagctggtggtaactcgagcactgatgatcacagctgacattttagctggctttggattcatcaccctgctccttggtctggactgtgtgaagttcctacctgatgacccacaaattaaagtccgcctttgctttgttgcagggaccacattactcattgcaggtaccccaggaatcatcggttctgtgtggtatgctgtggatgtttacgtcgaacgctcctctctcgttttacacaatatatttcttgggatccaatataaatttggttggtcctgctggcttggaatggctgggtctttgggttgctttttggcaggagctctcctcacctgctgtttgtacctcttcaaagatgttgggcctgagaggaactacccttatgccatgaggaagccctattcaactgcaggtgtgtccatggccaagtcctacaaggcccctcggacagagacagccaaaatgtatgctgtagacaccagagtataaaatctgcccaatgttaatctgtgttcctgtgccgtttaattactcaatcaatgtattcaagttaataaaataaatgatcgactttgaagcattcatttacatttctgatgcaaa

//