ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 21:21:12, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001170768 2060 bp mRNA linear MAM 01-JUL-2020
DEFINITION Sus scrofa cyclin B1 (CCNB1), mRNA.
ACCESSION NM_001170768
VERSION NM_001170768.1
KEYWORDS RefSeq.
SOURCE Sus scrofa (pig)
ORGANISM Sus scrofa
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
Sus.
REFERENCE 1 (bases 1 to 2060)
AUTHORS Liu H, Gao Y, Zhai B, Jiang H, Ding Y, Zhang L, Li C, Deng Q, Yu X
and Zhang J.
TITLE The Effects of Polyadenylation Status on MPFs During In Vitro
Porcine Oocyte Maturation
JOURNAL Cell. Physiol. Biochem. 39 (5), 1735-1745 (2016)
PUBMED 27744448
REMARK GeneRIF: Cyclin B1 plays a significant role in promoting the
maturation of large-follicle oocytes.
REFERENCE 2 (bases 1 to 2060)
AUTHORS Li S, Kang JD, Jin JX, Hong Y, Zhu HY, Jin L, Gao QS, Yan CG, Cui
CD, Li WX and Yin XJ.
TITLE Effect of demecolcine-assisted enucleation on the MPF level and
cyclin B1 distribution in porcine oocytes
JOURNAL PLoS ONE 9 (3), e91483 (2014)
PUBMED 24626152
REMARK GeneRIF: cyclin B1 distribution in porcine oocytes is affected by
demecolcine-assisted enucleation
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 2060)
AUTHORS Zhang DX, Cui XS and Kim NH.
TITLE Molecular characterization and polyadenylation-regulated expression
of cyclin B1 and Cdc2 in porcine oocytes and early parthenotes
JOURNAL Mol. Reprod. Dev. 77 (1), 38-50 (2010)
PUBMED 19705412
REMARK GeneRIF: Results describe the expression of maternal cyclin B1 and
Cdc2 during in vitro maturation of porcine oocytes.
REFERENCE 4 (bases 1 to 2060)
AUTHORS Sugiura K, Naito K, Endo T and Tojo H.
TITLE Study of germinal vesicle requirement for the normal kinetics of
maturation/M-phase-promoting factor activity during porcine oocyte
maturation
JOURNAL Biol. Reprod. 74 (3), 593-600 (2006)
PUBMED 16319287
REMARK GeneRIF: germinal vesicle is not required for the activation of M
phase promoting factor during the first meiosis, but it is required
for the second meiosis because of its promotion of CCNB1
accumulation
GeneRIF: germinal vesicles are not required for the activation of
MPF during the first meiosis, but they are required for the second
meiosis because of its promotion of CCNB1 accumulation.
REFERENCE 5 (bases 1 to 2060)
AUTHORS Anger M, Klima J, Kubelka M, Prochazka R, Motlik J and Schultz RM.
TITLE Timing of Plk1 and MPF activation during porcine oocyte maturation
JOURNAL Mol. Reprod. Dev. 69 (1), 11-16 (2004)
PUBMED 15278898
REFERENCE 6 (bases 1 to 2060)
AUTHORS Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H,
Okumura N, Hamasima N and Awata T.
TITLE PEDE (Pig EST Data Explorer): construction of a database for ESTs
derived from porcine full-length cDNA libraries
JOURNAL Nucleic Acids Res. 32 (Database issue), D484-D488 (2004)
PUBMED 14681463
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from GQ184632.1.
##Evidence-Data-START##
Transcript exon combination :: GQ184632.1, AK240474.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN02584787 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..2060
/organism="Sus scrofa"
/mol_type="mRNA"
/db_xref="taxon:9823"
/chromosome="16"
/map="16"
gene 1..2060
/gene="CCNB1"
/note="cyclin B1"
/db_xref="GeneID:397662"
/db_xref="VGNC:VGNC:86349"
exon 1..153
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
misc_feature 100..102
/gene="CCNB1"
/note="upstream in-frame stop codon"
CDS 133..1440
/gene="CCNB1"
/note="cyclin B; G2/mitotic-specific cyclin B1"
/codon_start=1
/product="G2/mitotic-specific cyclin-B1"
/protein_id="NP_001164239.1"
/db_xref="GeneID:397662"
/db_xref="VGNC:VGNC:86349"
/translation="
MALRITRNTKINAENKAKISMAGAKRVPVASAATSKPGLRPRTALGDIGNKVSEQPQAKLPLKKEAKTLAAGKVVAKKLPKPLEKAPVPVLEPQPEREPEPELEPEPEPEPVKGEKLSPEPILVDTPSPSPMETSGCAPAEEYLCQAFSDVILAVNDVDAEDGGDPNLCSEYVKDIYDYLRQLEEEQAVRPKYLLGREVTGNMRAILIDWLVQVQMKFRLLQETMYMTVSIIDRFMQDNCVPKKMLQLVGVTAMFIASKYEEMYPPEIGDFAFVTDNTYTKYQIRQMEMKILRALNFCLGRPLPLHFLRRASKIGEVDVELHTLAKYLMELTMLDYDMVHFPPSQIAAGAFCLSLKILDNGEWTPTLQHYLSYTEESLLVVMQHLAKNIVVVNRGLTKHMTIKNKYATSKHAKISTLAQLNSALVQDLAKAVAKV"
misc_feature 637..1023
/gene="CCNB1"
/note="first cyclin box found in G2/mitotic-specific
cyclin-B1 (CCNB1); Region: CYCLIN_CCNB1_rpt1; cd20565"
/db_xref="CDD:410268"
misc_feature order(643..648,655..660,667..672,679..681,895..900,
907..921,928..936,985..987,994..999,1006..1011,1018..1023)
/gene="CCNB1"
/note="CDK interface [polypeptide binding]; other site"
/db_xref="CDD:410268"
misc_feature 1036..1398
/gene="CCNB1"
/note="Cyclin box fold superfamily; Region: CYCLIN_SF;
cl40454"
/db_xref="CDD:477360"
exon 154..324
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 325..501
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 502..684
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 685..843
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 844..1080
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 1081..1221
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 1222..1332
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
exon 1333..2045
/gene="CCNB1"
/inference="alignment:Splign:2.1.0"
ORIGIN
ccggattcctcccggcgtgctgcggaggaacggctgttagctagtggtggcttcaaggtccccggctggtcggggctccagtgctctgcttctcccctctgagctgctgcctggcctggtacagaggaagtcatggcgctccggatcaccaggaacacgaaaattaatgctgaaaataaggcgaagatcagtatggcaggcgcaaagcgcgtgcctgtggcctctgctgcaacctctaagcccggactgaggccaagaactgctcttggagacatcggtaacaaagtcagtgaacagccacaggccaaactgcctctgaaaaaggaagcaaaaactttagctgctggaaaagttgttgctaaaaaactaccgaaacctctggaaaaggctcctgtacctgtattagagccccagccagagagggagcccgagcctgaactggagcctgaaccagaacctgagcctgttaaaggagagaaactttcccctgaacctattttggttgatactccctctccaagccccatggaaacatctggctgtgcccctgcagaagaatatttgtgtcaggctttctctgatgtaattcttgcagtgaatgatgtggatgcagaagatggaggggatccaaacctttgtagtgaatatgtgaaagatatctatgattatctgagacaacttgaggaagaacaagcagttagaccaaaatacctactgggtcgtgaagtcactggaaacatgagagccatcctaattgactggctagtgcaggttcagatgaaattcaggttactacaggagaccatgtacatgacagtttccattattgatcggttcatgcaggataattgtgtgcccaagaagatgctccaactggttggtgtcactgccatgtttattgccagcaaatatgaagaaatgtaccctccagaaattggtgactttgcctttgtgactgacaatacttacactaagtaccaaatcaggcagatggaaatgaagattctaagagcattaaatttttgtctgggtcgccctctacccctgcattttcttcggagagcatccaagattggagaggttgatgttgagttacatactttggccaaatatctgatggagctaactatgttggactacgatatggtgcactttcctccttctcagatcgcagcaggagctttttgcctatccctgaagattcttgataatggtgaatggacaccaactctacagcattacctgtcatacactgaagaatcccttcttgtggttatgcaacacttggctaagaatatcgtcgtggtgaatcgagggcttacaaagcacatgactatcaagaacaagtatgccacatctaagcatgctaagatcagcactctagcccagctgaattcagcactagttcaagatttagccaaggctgtggcaaaggtgtaacttgtgaacttcggaatactataatatctacaaataaaattggcaccatgtgccatctgtacatattatatgttacacttatttacttttaataaagtttgtagtcctttttacttcttaactcatttgaatgtggctatttcccacttgaggataacttaaaagttgtcttaaaggtacagtggagaatgttttttaaaaaatgaaaactgttttcagttacctgggaacccaactaatatatacaattggctcttcttgttttatgtacttggcataacttaattaatatgagttcatatagtcttgaagccatttaatatctttatatgttacactgtatgtaagctcagtcatcttgagagaatctgctacctagttctacacaaggaagagtctaccgtctcaatcctagtccccttgttttatatttcctctggtggctgcagtcataatcctaaataatctacttgtaccactttcttaaattatcaactttagtatcaactttttcacttggaaaaatgagaattttaatttatattcaaaacctaatttactttttgtttattggttaagaaaaataaaacaatccttagaacaaaaaaacaaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]