2024-05-29 10:17:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039904 61 bp RNA linear PRI 19-APR-2022 DEFINITION Homo sapiens microRNA 4749 (MIR4749), microRNA. ACCESSION NR_039904 VERSION NR_039904.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 61) AUTHORS Botti V, Marrone S, Cannistraro S and Bizzarri AR. TITLE Interaction between miR4749 and Human Serum Albumin as Revealed by Fluorescence, FRET, Atomic Force Spectroscopy and Computational Modelling JOURNAL Int J Mol Sci 23 (3), 1291 (2022) PUBMED 35163220 REMARK GeneRIF: Interaction between miR4749 and Human Serum Albumin as Revealed by Fluorescence, FRET, Atomic Force Spectroscopy and Computational Modelling. Publication Status: Online-Only REFERENCE 2 (bases 1 to 61) AUTHORS Bizzarri AR and Cannistraro S. TITLE Investigation of a Direct Interaction between miR4749 and the Tumor Suppressor p53 by Fluorescence, FRET and Molecular Modeling JOURNAL Biomolecules 10 (2), E346 (2020) PUBMED 32098369 REMARK GeneRIF: Investigation of a Direct Interaction between miR4749 and the Tumor Suppressor p53 by Fluorescence, FRET and Molecular Modeling. Publication Status: Online-Only REFERENCE 3 (bases 1 to 61) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 61) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 5 (bases 1 to 61) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 6 (bases 1 to 61) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC018766.2. On May 30, 2012 this sequence version replaced NR_039904.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611407.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-61 AC018766.2 30096-30156 FEATURES Location/Qualifiers source 1..61 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.33" gene 1..61 /gene="MIR4749" /gene_synonym="mir-4749" /note="microRNA 4749" /db_xref="GeneID:100616313" /db_xref="HGNC:HGNC:41760" /db_xref="miRBase:MI0017388" precursor_RNA 1..61 /gene="MIR4749" /gene_synonym="mir-4749" /product="microRNA 4749" /db_xref="GeneID:100616313" /db_xref="HGNC:HGNC:41760" /db_xref="miRBase:MI0017388" exon 1..61 /gene="MIR4749" /gene_synonym="mir-4749" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:762281105" ncRNA 3..24 /ncRNA_class="miRNA" /gene="MIR4749" /gene_synonym="mir-4749" /product="hsa-miR-4749-5p" /db_xref="miRBase:MIMAT0019885" /db_xref="GeneID:100616313" /db_xref="HGNC:HGNC:41760" /db_xref="miRBase:MI0017388" variation 4 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /db_xref="dbSNP:770355657" variation 5 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:370929811" variation 6 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /db_xref="dbSNP:552910419" variation 9 /gene="MIR4749" /gene_synonym="mir-4749" /replace="g" /replace="t" /db_xref="dbSNP:766523467" variation 14 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /db_xref="dbSNP:2074380085" variation 15 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:751761421" variation 17 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /db_xref="dbSNP:759326327" variation 20 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /db_xref="dbSNP:2074380413" variation 21 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:747312801" variation 24 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:1336524397" variation 27 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /db_xref="dbSNP:374560183" variation 31 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:752576001" variation 33 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /db_xref="dbSNP:756115404" variation 34 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:201967614" variation 35 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="c" /db_xref="dbSNP:1233931883" variation 36 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:753338524" ncRNA 42..61 /ncRNA_class="miRNA" /gene="MIR4749" /gene_synonym="mir-4749" /product="hsa-miR-4749-3p" /db_xref="miRBase:MIMAT0019886" /db_xref="GeneID:100616313" /db_xref="HGNC:HGNC:41760" /db_xref="miRBase:MI0017388" variation 42 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:147943327" variation 43 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:148982635" variation 44 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:372882504" variation 45 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:200056596" variation 46 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:570340094" variation 47 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:2074381708" variation 51 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:2074381778" variation 52 /gene="MIR4749" /gene_synonym="mir-4749" /replace="g" /replace="t" /db_xref="dbSNP:1568640129" variation 53..57 /gene="MIR4749" /gene_synonym="mir-4749" /replace="cccc" /replace="ccccc" /db_xref="dbSNP:778438436" variation 53 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /db_xref="dbSNP:2074381968" variation 54 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="t" /db_xref="dbSNP:748573000" variation 55 /gene="MIR4749" /gene_synonym="mir-4749" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:770230641" variation 57 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /db_xref="dbSNP:201103722" variation 61 /gene="MIR4749" /gene_synonym="mir-4749" /replace="c" /replace="g" /db_xref="dbSNP:2074382441" ORIGIN
cctgcggggacaggccagggcatctaggctgtgcacagtgacgcccctcctgcccccacag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]