GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 04:41:16, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_011541236           13721 bp    mRNA    linear   PRI 05-OCT-2023
DEFINITION  PREDICTED: Homo sapiens argonaute RISC component 1 (AGO1),
            transcript variant X1, mRNA.
ACCESSION   XM_011541236
VERSION     XM_011541236.3
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000001.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 5, 2022 this sequence version replaced XM_011541236.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001405.40-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..13721
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
     gene            1..13721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="argonaute RISC component 1; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 5
                     mRNAs, 32 ESTs, 2449 long SRA reads, 5 Proteins, and 92%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 67 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:26523"
                     /db_xref="HGNC:HGNC:3262"
                     /db_xref="MIM:606228"
     variation       6
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978051547"
     variation       9
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645056876"
     variation       13
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175381189"
     variation       14
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287948787"
     variation       18
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488473859"
     variation       19
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220406709"
     variation       20..45
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="ctcgcagtgggagctgctgcaggctc"
                     /db_xref="dbSNP:1244564144"
     variation       20
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645057149"
     variation       21
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489178234"
     variation       22
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745709197"
     variation       23
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645057343"
     variation       24
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571337067"
     variation       25
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379140477"
     variation       27
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442648369"
     variation       28
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645057533"
     variation       32
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160937987"
     variation       33
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955272510"
     variation       35
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166868030"
     variation       37
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571337095"
     variation       38
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321841535"
     variation       39
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536512687"
     variation       40
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571337106"
     variation       44
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960542884"
     variation       45
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988496009"
     variation       46..49
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cgcg"
                     /replace="cgcgcg"
                     /db_xref="dbSNP:1330829239"
     variation       46
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:796799611"
     variation       47..57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcggcggc"
                     /replace="gcggcggcggc"
                     /replace="gcggcggcggcggc"
                     /db_xref="dbSNP:879546980"
     variation       47
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296078355"
     variation       48
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645058154"
     variation       49..81
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggcggcggc"
                     /replace="ggcggcggcaacggaggctgcgggggcggcggc"
                     /db_xref="dbSNP:1645058301"
     variation       49
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227464220"
     variation       51
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763454879"
     variation       52
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323203976"
     variation       54
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968367755"
     variation       55
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237075493"
     variation       56..57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gctgc"
                     /db_xref="dbSNP:1645058523"
     variation       57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978548875"
     variation       58
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181076845"
     variation       59
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239255916"
     variation       62
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645058668"
     variation       65
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867649714"
     variation       68..80
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcgg"
                     /replace="gcgggggcggcgg"
                     /db_xref="dbSNP:921662839"
     variation       69
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645058877"
     variation       70
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931863745"
     variation       72..95
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggc"
                     /replace="gggcggcggcgcgagcggccgggc"
                     /db_xref="dbSNP:1645059013"
     variation       75
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379985904"
     variation       78
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941176687"
     variation       79
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398233997"
     variation       81
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059243"
     variation       83
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059390"
     variation       85
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645059442"
     variation       86
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467201069"
     variation       87
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333289576"
     variation       90
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059570"
     variation       91
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059619"
     variation       98
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059665"
     variation       99
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336348406"
     variation       101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1038631951"
     variation       104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645059778"
     variation       105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918304981"
     variation       106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645059864"
     variation       109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059915"
     variation       112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059958"
     variation       113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645060009"
     variation       115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381028483"
     variation       116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256973986"
     variation       120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929736854"
     variation       121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645060253"
     variation       126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1045368943"
     variation       127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547802847"
     variation       128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645060435"
     variation       129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906900125"
     variation       132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1003735845"
     variation       135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569338309"
     variation       136..140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1645060711"
     variation       137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645060739"
     variation       138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537033546"
     variation       142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239615580"
     variation       143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148706022"
     variation       144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571337241"
     variation       145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571337258"
     variation       147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645060959"
     variation       148
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055353380"
     variation       150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645061351"
     variation       151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645061389"
     variation       155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895405324"
     variation       156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011034611"
     variation       159
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193238281"
     variation       162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645061557"
     variation       163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376952387"
     variation       164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478922696"
     variation       165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:558415281"
     variation       170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479948110"
     variation       171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331202747"
     variation       173..176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:754610928"
     variation       174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748181964"
     variation       176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767091091"
     variation       178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167301864"
     variation       179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332063452"
     variation       181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374168686"
     variation       182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415108216"
     variation       183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645062143"
     variation       184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426651719"
     variation       187
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277181222"
     variation       188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022891969"
     variation       189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571337349"
     variation       191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:570480872"
     variation       193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365195293"
     variation       194..198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="cctcc"
                     /db_xref="dbSNP:1645062511"
     variation       194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377185293"
     variation       195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369200771"
     variation       198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369830249"
     variation       199..200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1645062720"
     variation       199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227307292"
     variation       200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774749949"
     variation       202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645062813"
     variation       203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746274013"
     variation       204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999650573"
     variation       205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312478731"
     variation       206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571337398"
     variation       207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771695172"
     variation       210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645063088"
     variation       211..213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1378065562"
     CDS             214..2796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X1"
                     /protein_id="XP_011539538.1"
                     /db_xref="GeneID:26523"
                     /db_xref="HGNC:HGNC:3262"
                     /db_xref="MIM:606228"
                     /translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRVSRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
     misc_feature    313..705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    733..885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    886..1248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1042..1044,1087..1089,1129..1131,1141..1143,
                     1195..1197,1216..1218,1222..1224)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1381..2667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1801..1803,1813..1815,1849..1860,1867..1869,
                     1891..1893,1900..1902,1912..1914,1924..1926)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2005..2007,2011..2013,2221..2223,2635..2637)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="active site"
                     /db_xref="CDD:240015"
     variation       220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291952738"
     variation       221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775125489"
     variation       227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219859778"
     variation       228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645063342"
     variation       229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763615615"
     variation       230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228530087"
     variation       231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776166589"
     variation       233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761778204"
     variation       234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571337459"
     variation       235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645063687"
     variation       237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765152517"
     variation       239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534382148"
     variation       241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12746607"
     variation       242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146814747"
     variation       243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972036410"
     variation       245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144077445"
     variation       246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140869088"
     variation       247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170596078"
     variation       248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645155622"
     variation       255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340212230"
     variation       256..262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:752471592"
     variation       258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645155750"
     variation       259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206703390"
     variation       260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760951179"
     variation       261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202083240"
     variation       262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557603507"
     variation       263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148708759"
     variation       264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138410930"
     variation       266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757285327"
     variation       269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1022788713"
     variation       270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240989789"
     variation       271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446100175"
     variation       272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571342863"
     variation       273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79428335"
     variation       274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75289061"
     variation       275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645156392"
     variation       276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76388453"
     variation       279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645156505"
     variation       281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156570"
     variation       284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156617"
     variation       286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779432389"
     variation       287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258716583"
     variation       288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163754955"
     variation       289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156991"
     variation       290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389168609"
     variation       297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424891938"
     variation       298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750911996"
     variation       300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968257736"
     variation       305
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758952997"
     variation       307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355653345"
     variation       308
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262459523"
     variation       309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574337653"
     variation       313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645157658"
     variation       315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179019303"
     variation       316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335156626"
     variation       319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747438396"
     variation       321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385353517"
     variation       325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645157898"
     variation       327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418697160"
     variation       334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179971147"
     variation       335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926553379"
     variation       339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768283757"
     variation       347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297216732"
     variation       349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199891800"
     variation       354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337673800"
     variation       356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868103064"
     variation       361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146957455"
     variation       363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200988923"
     variation       364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773153331"
     variation       366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762965113"
     variation       378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143228790"
     variation       388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286109881"
     variation       390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645158647"
     variation       394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347111293"
     variation       395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448364494"
     variation       396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74665168"
     variation       397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764307761"
     variation       398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042059854"
     variation       400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645159128"
     variation       401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645159199"
     variation       408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321314626"
     variation       412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200676269"
     variation       413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645159446"
     variation       416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251930499"
     variation       417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564776109"
     variation       419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194249910"
     variation       420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375999904"
     variation       426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755840915"
     variation       429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039211966"
     variation       438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645239978"
     variation       439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777119725"
     variation       446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355230423"
     variation       447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645240094"
     variation       448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748876689"
     variation       450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294130512"
     variation       460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645240210"
     variation       462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770982492"
     variation       475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774432228"
     variation       476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745615692"
     variation       486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645240476"
     variation       500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148710841"
     variation       507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487074387"
     variation       513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187568812"
     variation       518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368596181"
     variation       520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373509253"
     variation       521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998200306"
     variation       522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771782526"
     variation       525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775400690"
     variation       529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645243206"
     variation       537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761909595"
     variation       538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371043471"
     variation       542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773265965"
     variation       546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037229267"
     variation       547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766471361"
     variation       548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867858441"
     variation       549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645251826"
     variation       555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479111626"
     variation       556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645251932"
     variation       559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645251969"
     variation       561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774463509"
     variation       562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645252076"
     variation       564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306694761"
     variation       568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557606462"
     variation       583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327559774"
     variation       591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759929800"
     variation       600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645252397"
     variation       601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557606472"
     variation       606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768140024"
     variation       613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645252575"
     variation       616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974811600"
     variation       629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748561732"
     variation       632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756518480"
     variation       633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763796047"
     variation       642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645252872"
     variation       643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645252917"
     variation       645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140048484"
     variation       646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406926679"
     variation       648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778531571"
     variation       651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750019410"
     variation       654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551846586"
     variation       655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780052272"
     variation       660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1295434292"
     variation       661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044509129"
     variation       663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645253450"
     variation       664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746713624"
     variation       667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356391187"
     variation       670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645253604"
     variation       671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768528277"
     variation       672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777924524"
     variation       673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348951466"
     variation       674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225740432"
     variation       678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146336392"
     variation       682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398998653"
     variation       684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771183369"
     variation       685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645254066"
     variation       686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774413049"
     variation       688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275859576"
     variation       689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275269608"
     variation       693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645254286"
     variation       697
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645254328"
     variation       699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000221753"
     variation       703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759723959"
     variation       706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298655751"
     variation       707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645254551"
     variation       708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204721590"
     variation       711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250637242"
     variation       712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481913947"
     variation       715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200107860"
     variation       720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772403603"
     variation       730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757928895"
     variation       733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148711333"
     variation       735
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339623786"
     variation       741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935986859"
     variation       742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369913779"
     variation       747..754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:1553154062"
     variation       749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450839608"
     variation       750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557606960"
     variation       756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216160432"
     variation       758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196584082"
     variation       759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923359271"
     variation       764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243777480"
     variation       765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054485245"
     variation       776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571348661"
     variation       777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751539508"
     variation       779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553154069"
     variation       780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754921891"
     variation       782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645264815"
     variation       786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645264900"
     variation       789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571348686"
     variation       794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388452609"
     variation       795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645265183"
     variation       796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711374"
     variation       797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780934730"
     variation       800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:745945344"
     variation       804
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148711380"
     variation       808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711383"
     variation       816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390406046"
     variation       821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645265474"
     variation       827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385468503"
     variation       835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557607042"
     variation       857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415969084"
     variation       858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320779237"
     variation       861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645265786"
     variation       867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11806527"
     variation       870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11811275"
     variation       880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751072190"
     variation       881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281040808"
     variation       882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645271909"
     variation       888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299243666"
     variation       893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754906190"
     variation       894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2296470"
     variation       899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645272259"
     variation       904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571349090"
     variation       907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266180488"
     variation       908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372933409"
     variation       911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204384593"
     variation       913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255631567"
     variation       915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201138355"
     variation       918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184303864"
     variation       925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645272758"
     variation       927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364687783"
     variation       932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778966083"
     variation       933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645272959"
     variation       937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17855789"
     variation       939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758584590"
     variation       942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362228512"
     variation       946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273227"
     variation       948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010672520"
     variation       952
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1422475379"
     variation       954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645273440"
     variation       955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018151324"
     variation       957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273614"
     variation       959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470621142"
     variation       960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780175783"
     variation       961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400919651"
     variation       965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273887"
     variation       971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645273962"
     variation       972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747113992"
     variation       973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645274152"
     variation       978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769226315"
     variation       987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350821626"
     variation       998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770562881"
     variation       999..1000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:34232554"
     variation       1000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645278321"
     variation       1005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645278406"
     variation       1010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773882882"
     variation       1014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191695845"
     variation       1017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428675136"
     variation       1020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166366490"
     variation       1028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645278705"
     variation       1031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759010563"
     variation       1044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372555392"
     variation       1045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645278907"
     variation       1047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759416843"
     variation       1048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533050841"
     variation       1050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292791760"
     variation       1052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711775"
     variation       1054..1055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:2148711782"
     variation       1054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1162477236"
     variation       1056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760596663"
     variation       1059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551240186"
     variation       1060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571349540"
     variation       1062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570547124"
     variation       1063
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645279527"
     variation       1066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645279588"
     variation       1068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571349563"
     variation       1069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571349566"
     variation       1071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1364584684"
     variation       1072
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761517181"
     variation       1075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645279945"
     variation       1085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294234936"
     variation       1086..1141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="att"
                     /replace="attccccttacagctggagagtggacagactgtggagtgcacagtggc
                     acagtatt"
                     /db_xref="dbSNP:1557608209"
     variation       1086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753991581"
     variation       1089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645296230"
     variation       1091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295256848"
     variation       1092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189586551"
     variation       1103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051022486"
     variation       1107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238748148"
     variation       1115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472903106"
     variation       1116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372979737"
     variation       1120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148712287"
     variation       1124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296616"
     variation       1126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306020581"
     variation       1131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296748"
     variation       1136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296815"
     variation       1146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050283350"
     variation       1155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546553880"
     variation       1156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420666776"
     variation       1161
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645297028"
     variation       1166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757631001"
     variation       1176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909137877"
     variation       1177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411142617"
     variation       1182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645297285"
     variation       1188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756155452"
     variation       1189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338758069"
     variation       1200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645297454"
     variation       1204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759454083"
     variation       1212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359860901"
     variation       1221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447524690"
     variation       1224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778306053"
     variation       1227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149082767"
     variation       1228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151208943"
     variation       1236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275974433"
     variation       1240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148715329"
     variation       1242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775889960"
     variation       1243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200563862"
     variation       1244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557612017"
     variation       1249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415960544"
     variation       1255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764062753"
     variation       1257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050570393"
     variation       1258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908985871"
     variation       1259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148715349"
     variation       1263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416045"
     variation       1268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343816827"
     variation       1269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753994302"
     variation       1277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278173586"
     variation       1278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757689155"
     variation       1283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645416400"
     variation       1284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416455"
     variation       1292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416507"
     variation       1293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199616208"
     variation       1296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200825557"
     variation       1320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758791735"
     variation       1324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715372"
     variation       1329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779631833"
     variation       1332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645416806"
     variation       1334..1341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggag"
                     /replace="aggaggag"
                     /db_xref="dbSNP:2148715376"
     variation       1336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762638025"
     variation       1338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746619529"
     variation       1340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430592479"
     variation       1344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168233985"
     variation       1346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1369030058"
     variation       1348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754699172"
     variation       1350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274129921"
     variation       1351
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780563736"
     variation       1359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750947963"
     variation       1360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404044449"
     variation       1361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148715571"
     variation       1364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715573"
     variation       1367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320886676"
     variation       1370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645424335"
     variation       1371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424415"
     variation       1373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148715578"
     variation       1374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424467"
     variation       1381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424528"
     variation       1382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758951181"
     variation       1386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72661614"
     variation       1389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296302699"
     variation       1392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028013"
     variation       1395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002104589"
     variation       1398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868287969"
     variation       1401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754573452"
     variation       1404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328358090"
     variation       1407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542457159"
     variation       1412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284524734"
     variation       1415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780911842"
     variation       1416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425246"
     variation       1417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1226472292"
     variation       1420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557612417"
     variation       1421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425404"
     variation       1423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645425456"
     variation       1424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425501"
     variation       1425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747545727"
     variation       1430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715621"
     variation       1432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755717690"
     variation       1433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425695"
     variation       1438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208181934"
     variation       1443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645425811"
     variation       1447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571357990"
     variation       1448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376308772"
     variation       1449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377394072"
     variation       1451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544024909"
     variation       1452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142094247"
     variation       1456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472015606"
     variation       1458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161925549"
     variation       1467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745684571"
     variation       1470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61751003"
     variation       1471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893311782"
     variation       1473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645426498"
     variation       1474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935068063"
     variation       1475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645426594"
     variation       1478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571358046"
     variation       1480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571358047"
     variation       1483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382173701"
     variation       1485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397379451"
     variation       1488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645430270"
     variation       1489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779760591"
     variation       1490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258906885"
     variation       1491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645430440"
     variation       1494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748337975"
     variation       1495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428424991"
     variation       1502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015543488"
     variation       1506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199936275"
     variation       1512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773266381"
     variation       1518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763034859"
     variation       1519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432427531"
     variation       1524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771277669"
     variation       1525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170126627"
     variation       1526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645431243"
     variation       1528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148715842"
     variation       1530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148715846"
     variation       1531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431327"
     variation       1532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370865156"
     variation       1533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774954734"
     variation       1536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431506"
     variation       1539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759771963"
     variation       1542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369633288"
     variation       1546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431703"
     variation       1547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387317470"
     variation       1551
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571358401"
     variation       1553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313546401"
     variation       1557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300648006"
     variation       1562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371917876"
     variation       1564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368914800"
     variation       1566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557612737"
     variation       1573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753155364"
     variation       1575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760403306"
     variation       1580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645432313"
     variation       1581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375102195"
     variation       1584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645432435"
     variation       1585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262161642"
     variation       1586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753328428"
     variation       1593
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919044941"
     variation       1604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203451050"
     variation       1615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569514136"
     variation       1617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023867293"
     variation       1623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199479145"
     variation       1629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645532937"
     variation       1632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645533022"
     variation       1635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945694295"
     variation       1639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775988217"
     variation       1640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761121371"
     variation       1641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645533275"
     variation       1646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12739932"
     variation       1656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763795877"
     variation       1658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148718885"
     variation       1659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184426040"
     variation       1666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415613590"
     variation       1669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557615824"
     variation       1680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776441734"
     variation       1683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769789947"
     variation       1684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163885953"
     variation       1698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040031325"
     variation       1701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12735795"
     variation       1703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12735796"
     variation       1704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368806171"
     variation       1708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167063899"
     variation       1714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645534232"
     variation       1716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458793259"
     variation       1717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998417309"
     variation       1722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340285630"
     variation       1725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148718923"
     variation       1726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421049999"
     variation       1727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645534556"
     variation       1729
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201120683"
     variation       1730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645534737"
     variation       1731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466906554"
     variation       1732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006126627"
     variation       1733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321275499"
     variation       1734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764770945"
     variation       1737
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749967453"
     variation       1740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758341990"
     variation       1742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341527708"
     variation       1747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380272290"
     variation       1748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143395835"
     variation       1749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751289476"
     variation       1751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200447801"
     variation       1752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754799646"
     variation       1753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645535695"
     variation       1755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050019769"
     variation       1761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371346774"
     variation       1765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268149326"
     variation       1772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645536021"
     variation       1776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401160206"
     variation       1785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645536136"
     variation       1794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749491572"
     variation       1797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757463904"
     variation       1815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645685994"
     variation       1816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385910631"
     variation       1817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758585726"
     variation       1819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645686189"
     variation       1821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780324190"
     variation       1830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645686375"
     variation       1833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723061"
     variation       1836
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747499045"
     variation       1847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769346828"
     variation       1848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199790587"
     variation       1857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225197236"
     variation       1861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301736040"
     variation       1862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265127399"
     variation       1863..1864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645686932"
     variation       1864..1865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gggaacacaataatgac"
                     /db_xref="dbSNP:1645687001"
     variation       1869
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141975081"
     variation       1870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769429758"
     variation       1871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645687220"
     variation       1873
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300821067"
     variation       1874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571373923"
     variation       1875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888769037"
     variation       1881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645687499"
     variation       1884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645687560"
     variation       1885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645687616"
     variation       1892..1895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1645687661"
     variation       1894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343928483"
     variation       1899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723097"
     variation       1903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645687783"
     variation       1908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205604565"
     variation       1920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139495925"
     variation       1927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645688251"
     variation       1932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1038775292"
     variation       1936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432507106"
     variation       1945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762483320"
     variation       1950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778368573"
     variation       1953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223700131"
     variation       1956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247322617"
     variation       1963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645688704"
     variation       1965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164256024"
     variation       1971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770625415"
     variation       1972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528425591"
     variation       1974
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645692834"
     variation       1980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771935455"
     variation       1995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775325449"
     variation       1996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645693020"
     variation       2004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557621093"
     variation       2007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547329659"
     variation       2008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645693235"
     variation       2013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753726639"
     variation       2014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645693386"
     variation       2016..2021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:35257283"
     variation       2016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324407912"
     variation       2018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557621129"
     variation       2019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150639776"
     variation       2020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284611497"
     variation       2022
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149707892"
     variation       2024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723245"
     variation       2025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751632923"
     variation       2034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270050276"
     variation       2037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568739814"
     variation       2042..2046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:551219785"
     variation       2045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353927503"
     variation       2046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645694220"
     variation       2047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201807040"
     variation       2049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460339268"
     variation       2052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748183477"
     variation       2053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756692838"
     variation       2058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397084516"
     variation       2060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981999787"
     variation       2067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390797463"
     variation       2069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756572252"
     variation       2072
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754140760"
     variation       2073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757637094"
     variation       2074
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779294804"
     variation       2075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745501471"
     variation       2078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72661618"
     variation       2080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645715386"
     variation       2083
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715448"
     variation       2084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645715524"
     variation       2087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715568"
     variation       2091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455593427"
     variation       2098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779428711"
     variation       2104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746534916"
     variation       2105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571375783"
     variation       2108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571375789"
     variation       2112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348772102"
     variation       2114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715985"
     variation       2115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776733250"
     variation       2116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177037855"
     variation       2118
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148723911"
     variation       2119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747913193"
     variation       2121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251138878"
     variation       2128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548570122"
     variation       2130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769680596"
     variation       2143..2165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tcctacatggtgcgtgagctcct"
                     /replace="tcctacatggtgcgtgagctcctacatggtgcgtgagctcct"
                     /db_xref="dbSNP:1553156567"
     variation       2145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148568098"
     variation       2149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759663700"
     variation       2153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767845424"
     variation       2155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645716713"
     variation       2156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452226490"
     variation       2160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645716848"
     variation       2161
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170223877"
     variation       2163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775362502"
     variation       2166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461384946"
     variation       2169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296384917"
     variation       2172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:575591328"
     variation       2181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764455703"
     variation       2183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645717324"
     variation       2184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754370001"
     variation       2188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723971"
     variation       2189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369025845"
     variation       2200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762360695"
     variation       2201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296692574"
     variation       2202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147571046"
     variation       2203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750855900"
     variation       2205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723986"
     variation       2206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757924485"
     variation       2208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779770428"
     variation       2209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267744084"
     variation       2211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165442477"
     variation       2212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750985823"
     variation       2218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213741177"
     variation       2219
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754547764"
     variation       2220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466822711"
     variation       2221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645718693"
     variation       2226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190144851"
     variation       2227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262080535"
     variation       2229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780890292"
     variation       2231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12564106"
     variation       2237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769908492"
     variation       2244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645719049"
     variation       2247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645719104"
     variation       2252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1414634162"
     variation       2256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756047129"
     variation       2258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565958096"
     variation       2259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645758202"
     variation       2261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224957910"
     variation       2264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896742034"
     variation       2266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307134258"
     variation       2268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748984548"
     variation       2269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143104504"
     variation       2277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645758583"
     variation       2280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282114791"
     variation       2286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778610016"
     variation       2289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645758802"
     variation       2292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209966112"
     variation       2300..2303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148725180"
     variation       2304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645758944"
     variation       2310
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7512720"
     variation       2319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020631361"
     variation       2320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557623594"
     variation       2328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768936737"
     variation       2332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142277966"
     variation       2334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138262926"
     variation       2335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645759563"
     variation       2343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770238895"
     variation       2344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148725216"
     variation       2345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773801844"
     variation       2349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763410885"
     variation       2359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766745148"
     variation       2366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311510365"
     variation       2375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774636073"
     variation       2383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557623659"
     variation       2384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645760176"
     variation       2385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759256057"
     variation       2387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439738572"
     variation       2393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373512212"
     variation       2403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759990630"
     variation       2405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160280075"
     variation       2412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767227187"
     variation       2417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645772040"
     variation       2419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1272181556"
     variation       2421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305762819"
     variation       2422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645772202"
     variation       2423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015522007"
     variation       2424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394089472"
     variation       2428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438949295"
     variation       2429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328128014"
     variation       2431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371847135"
     variation       2432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775311574"
     variation       2434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962129831"
     variation       2442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278891860"
     variation       2443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645772715"
     variation       2445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760440138"
     variation       2451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763635186"
     variation       2462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645772906"
     variation       2464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191993432"
     variation       2466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370393930"
     variation       2469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757155977"
     variation       2474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148725560"
     variation       2475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765103292"
     variation       2476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750172296"
     variation       2478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423532922"
     variation       2490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761255422"
     variation       2507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557624574"
     variation       2511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765183489"
     variation       2513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750331557"
     variation       2523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396473268"
     variation       2526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762926752"
     variation       2527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400980541"
     variation       2529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309729088"
     variation       2531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351503366"
     variation       2533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766150388"
     variation       2534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371456175"
     variation       2535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416482791"
     variation       2541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293818805"
     variation       2544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148725983"
     variation       2547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756293606"
     variation       2550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777869344"
     variation       2556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753905238"
     variation       2559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351616919"
     variation       2564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148725999"
     variation       2565
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766341150"
     variation       2568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282516031"
     variation       2569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571380407"
     variation       2571
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779087158"
     variation       2573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645787177"
     variation       2586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746352418"
     variation       2587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144290045"
     variation       2590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1316031798"
     variation       2598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009486066"
     variation       2601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253810168"
     variation       2611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148726029"
     variation       2613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780502108"
     variation       2617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645787653"
     variation       2628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139104482"
     variation       2635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257568536"
     variation       2636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365053413"
     variation       2637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768309604"
     variation       2640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645787971"
     variation       2643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645788028"
     variation       2646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781573871"
     variation       2650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157651125"
     variation       2651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557624739"
     variation       2655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425163970"
     variation       2657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867363147"
     variation       2658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645788386"
     variation       2665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776181658"
     variation       2667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372029994"
     variation       2673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436350986"
     variation       2679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571380526"
     variation       2680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318627286"
     variation       2685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645788766"
     variation       2688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571380871"
     variation       2704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200112017"
     variation       2708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747745215"
     variation       2709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537312381"
     variation       2717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772641687"
     variation       2721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645794818"
     variation       2726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230155462"
     variation       2727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645794950"
     variation       2738
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252403207"
     variation       2739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339352983"
     variation       2745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748808273"
     variation       2751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367549238"
     variation       2752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314564307"
     variation       2755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774302590"
     variation       2758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759554925"
     variation       2773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371427797"
     variation       2779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009951542"
     variation       2781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778473881"
     variation       2790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764523718"
     variation       2791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775410850"
     variation       2793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761934070"
     variation       2799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765573016"
     variation       2805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750483408"
     variation       2806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645796023"
     variation       2807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645796066"
     variation       2810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758585810"
     variation       2814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766609131"
     variation       2815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325491422"
     variation       2816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365840620"
     variation       2818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751988702"
     variation       2821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755567551"
     variation       2825
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415466187"
     variation       2829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645796465"
     variation       2831
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399336214"
     variation       2837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645796571"
     variation       2841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376748083"
     variation       2842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217374400"
     variation       2844
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343703234"
     variation       2846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748552081"
     variation       2852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965243292"
     variation       2853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745575440"
     variation       2855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438723139"
     variation       2857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645796975"
     variation       2858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558595376"
     variation       2866
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369626433"
     variation       2874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797129"
     variation       2880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219639480"
     variation       2883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645797215"
     variation       2886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797274"
     variation       2891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381154"
     variation       2892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797336"
     variation       2896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381165"
     variation       2900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797421"
     variation       2906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797468"
     variation       2908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1321542247"
     variation       2909..2925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggatgccttgtttcct"
                     /replace="aggatgccttgtttcctaaggatgccttgtttcct"
                     /db_xref="dbSNP:1645797586"
     variation       2910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283260848"
     variation       2911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797684"
     variation       2914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797727"
     variation       2918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953916295"
     variation       2919
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797820"
     variation       2922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645797860"
     variation       2923
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571381191"
     variation       2924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571381199"
     variation       2926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645798304"
     variation       2927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314872898"
     variation       2929
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983883552"
     variation       2934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879239347"
     variation       2935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645798493"
     variation       2937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150023314"
     variation       2939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381230"
     variation       2940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909582929"
     variation       2941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025410190"
     variation       2946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759347470"
     variation       2947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381248"
     variation       2948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211269541"
     variation       2949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485412027"
     variation       2955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972780830"
     variation       2966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645799010"
     variation       2967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478628272"
     variation       2972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372514513"
     variation       2979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406280799"
     variation       2986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645799213"
     variation       2987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645799270"
     variation       2994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645799367"
     variation       2994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184496486"
     variation       2996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031125362"
     variation       3004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160196944"
     variation       3007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645799508"
     variation       3008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958110614"
     variation       3009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:949596040"
     variation       3012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1263585743"
     variation       3013..3016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1645799907"
     variation       3013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989617377"
     variation       3016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351587097"
     variation       3017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982388540"
     variation       3018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645800054"
     variation       3019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571381367"
     variation       3020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381375"
     variation       3022
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278837312"
     variation       3024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348418143"
     variation       3032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:541172177"
     variation       3042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571381393"
     variation       3045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645800369"
     variation       3047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202115790"
     variation       3049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288662217"
     variation       3051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645800533"
     variation       3054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645800586"
     variation       3055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571381418"
     variation       3056..3057
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:878964846"
     variation       3062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911352318"
     variation       3067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426560286"
     variation       3069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181957464"
     variation       3078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645800907"
     variation       3080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645800952"
     variation       3085..3091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="acaca"
                     /replace="acacaca"
                     /db_xref="dbSNP:977058838"
     variation       3089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922824952"
     variation       3093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148726405"
     variation       3095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360308850"
     variation       3100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645801187"
     variation       3101..3114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtgactcacagtg"
                     /db_xref="dbSNP:1645801236"
     variation       3102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183336786"
     variation       3106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938140807"
     variation       3110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187653963"
     variation       3111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571381510"
     variation       3112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645801465"
     variation       3115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474331605"
     variation       3117..3119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:2148726435"
     variation       3117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541984369"
     variation       3121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563307920"
     variation       3128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400788229"
     variation       3131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530845732"
     variation       3133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645801740"
     variation       3139
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545735322"
     variation       3140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042351647"
     variation       3143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411490768"
     variation       3145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645801948"
     variation       3149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645801989"
     variation       3150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760505499"
     variation       3155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343689135"
     variation       3159
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055654359"
     variation       3160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802314"
     variation       3165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901211923"
     variation       3168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225506641"
     variation       3172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894285520"
     variation       3173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802528"
     variation       3176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285541494"
     variation       3177..3178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645802682"
     variation       3177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802635"
     variation       3183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381598"
     variation       3186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726466"
     variation       3189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645802788"
     variation       3191..3202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gat"
                     /replace="gatactttagat"
                     /db_xref="dbSNP:1645802823"
     variation       3198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1644547952"
     variation       3200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645802872"
     variation       3203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645802921"
     variation       3206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564987081"
     variation       3208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949852940"
     variation       3220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213406425"
     variation       3221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273180555"
     variation       3223..3225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1645803165"
     variation       3228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045673538"
     variation       3229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206364733"
     variation       3230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645803305"
     variation       3231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903096962"
     variation       3232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484869602"
     variation       3233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998051016"
     variation       3237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645803490"
     variation       3239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190778316"
     variation       3240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028235058"
     variation       3244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573515805"
     variation       3247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999569691"
     variation       3268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166214313"
     variation       3269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726515"
     variation       3271..3278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="aggactag"
                     /db_xref="dbSNP:542709440"
     variation       3273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889712007"
     variation       3280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645803888"
     variation       3281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169098660"
     variation       3286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645804021"
     variation       3287..3294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1645804185"
     variation       3287..3288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:763151419"
     variation       3292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804239"
     variation       3297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804313"
     variation       3300..3302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1645804382"
     variation       3309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645804429"
     variation       3312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005763656"
     variation       3313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804548"
     variation       3315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335784510"
     variation       3317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016780880"
     variation       3318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645804829"
     variation       3320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010924348"
     variation       3326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116130930"
     variation       3328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557625376"
     variation       3330
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294728825"
     variation       3331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645805224"
     variation       3333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972530050"
     variation       3334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977320190"
     variation       3335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571381730"
     variation       3336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023962631"
     variation       3342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:16822444"
     variation       3345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645805569"
     variation       3364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202542245"
     variation       3369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645805687"
     variation       3371..3376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1481124682"
     variation       3377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446614001"
     variation       3379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645805834"
     variation       3382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979769602"
     variation       3391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982470959"
     variation       3393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926829253"
     variation       3394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645806069"
     variation       3396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406617402"
     variation       3399
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450110270"
     variation       3400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645806451"
     variation       3402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645806516"
     variation       3404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181016113"
     variation       3406..3417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="ccaccccccacc"
                     /db_xref="dbSNP:1645806646"
     variation       3409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751161957"
     variation       3411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157587098"
     variation       3412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2057606"
     variation       3413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402522809"
     variation       3414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766433433"
     variation       3420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807023"
     variation       3422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645807088"
     variation       3424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148726602"
     variation       3430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148726604"
     variation       3432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915647003"
     variation       3434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774454425"
     variation       3436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420740074"
     variation       3439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303406314"
     variation       3440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807432"
     variation       3442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645807482"
     variation       3445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645807546"
     variation       3446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807607"
     variation       3447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807682"
     variation       3449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807739"
     variation       3451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329847234"
     variation       3453
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807828"
     variation       3459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945440601"
     variation       3463..3469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcc"
                     /replace="ctcctcc"
                     /db_xref="dbSNP:1235948754"
     variation       3466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275775510"
     variation       3467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350357017"
     variation       3468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645808081"
     variation       3470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645808119"
     variation       3473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645808158"
     variation       3474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949953054"
     variation       3475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045968353"
     variation       3480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759722423"
     variation       3484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645808328"
     variation       3487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570108958"
     variation       3488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266648467"
     variation       3492..3501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taa"
                     /replace="taatacttaa"
                     /db_xref="dbSNP:1645808475"
     variation       3498..3500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tta"
                     /replace="ttatta"
                     /db_xref="dbSNP:1431340111"
     variation       3498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302778723"
     variation       3503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042485212"
     variation       3506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378011808"
     variation       3508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645808743"
     variation       3509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645808782"
     variation       3511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322040566"
     variation       3532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363876827"
     variation       3533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767682331"
     variation       3535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148726670"
     variation       3539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390382219"
     variation       3541..3549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cttcc"
                     /replace="cttccttcc"
                     /db_xref="dbSNP:934536365"
     variation       3543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645809082"
     variation       3544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324604644"
     variation       3548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369176195"
     variation       3549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933953211"
     variation       3550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275467706"
     variation       3552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148726687"
     variation       3553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544835378"
     variation       3554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226871979"
     variation       3556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645809561"
     variation       3562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645809599"
     variation       3566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645809645"
     variation       3567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290514635"
     variation       3568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756407221"
     variation       3577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309107602"
     variation       3584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018350753"
     variation       3585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777135778"
     variation       3586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645810043"
     variation       3587..3590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taat"
                     /replace="taataat"
                     /db_xref="dbSNP:767987739"
     variation       3587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810115"
     variation       3597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005485340"
     variation       3601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645810360"
     variation       3606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267896119"
     variation       3607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810475"
     variation       3608..3611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:899918123"
     variation       3608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998372574"
     variation       3609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810616"
     variation       3611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413786257"
     variation       3612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645810706"
     variation       3613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017159938"
     variation       3616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:897013046"
     variation       3621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810809"
     variation       3622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:993907860"
     variation       3626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645810891"
     variation       3627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372299339"
     variation       3629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030205426"
     variation       3630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1490719297"
     variation       3633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811096"
     variation       3634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366224993"
     variation       3635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764601080"
     variation       3636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983409479"
     variation       3638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811328"
     variation       3639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811390"
     variation       3640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645811438"
     variation       3650..3655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="aggtag"
                     /db_xref="dbSNP:756900274"
     variation       3652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564719281"
     variation       3655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11263836"
     variation       3656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726754"
     variation       3659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310206743"
     variation       3660..3672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ggaagaaataccc"
                     /db_xref="dbSNP:1645811737"
     variation       3661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811799"
     variation       3664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868386416"
     variation       3666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1351444886"
     variation       3669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571382102"
     variation       3670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414421664"
     variation       3673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382775879"
     variation       3675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645812125"
     variation       3690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537751988"
     variation       3692
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310777089"
     variation       3693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812276"
     variation       3695..3700
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agaaag"
                     /db_xref="dbSNP:1323589881"
     variation       3699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645812383"
     variation       3700
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440689421"
     variation       3702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812500"
     variation       3705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559288688"
     variation       3713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812623"
     variation       3714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163258781"
     variation       3721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645812827"
     variation       3724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991151309"
     variation       3725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812964"
     variation       3732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813038"
     variation       3741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979737204"
     variation       3742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813196"
     variation       3752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813267"
     variation       3753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813358"
     variation       3755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813438"
     variation       3758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813486"
     variation       3761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813558"
     variation       3763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253742631"
     variation       3767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426728596"
     variation       3771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570501842"
     variation       3785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645813750"
     variation       3789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180935385"
     variation       3790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253558654"
     variation       3792
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148726822"
     variation       3795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425105622"
     variation       3803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645814149"
     variation       3806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324508934"
     variation       3808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:2148726831"
     variation       3810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645814267"
     variation       3814..3817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctc"
                     /replace="tctctc"
                     /db_xref="dbSNP:1645814366"
     variation       3814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034039916"
     variation       3815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959872642"
     variation       3817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353978258"
     variation       3818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915698048"
     variation       3819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989776856"
     variation       3822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645814620"
     variation       3829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757779782"
     variation       3834
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645814719"
     variation       3835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148726853"
     variation       3838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440196918"
     variation       3840..3847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cctggcct"
                     /replace="cctggcctggcct"
                     /db_xref="dbSNP:1645814975"
     variation       3840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299799751"
     variation       3842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645815037"
     variation       3843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571382230"
     variation       3849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815140"
     variation       3852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726863"
     variation       3856
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645815205"
     variation       3857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534583086"
     variation       3858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381602990"
     variation       3859..3882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cctccttttctccttattcctcct"
                     /replace="cctccttttctccttattcctccttttctccttattcctcct"
                     /db_xref="dbSNP:1553157181"
     variation       3862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396729640"
     variation       3870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294910497"
     variation       3871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815599"
     variation       3874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726875"
     variation       3875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363066192"
     variation       3878
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815689"
     variation       3881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226112037"
     variation       3883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981302878"
     variation       3885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815832"
     variation       3887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342612616"
     variation       3889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778328049"
     variation       3890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745361943"
     variation       3892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645816080"
     variation       3894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312596434"
     variation       3895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645816207"
     variation       3898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645816260"
     variation       3905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726894"
     variation       3906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645816341"
     variation       3907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148726901"
     variation       3913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934611109"
     variation       3914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645816494"
     variation       3917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361359690"
     variation       3918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645816630"
     variation       3921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182044331"
     variation       3922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645816747"
     variation       3924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1246905719"
     variation       3930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922654018"
     variation       3931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228516462"
     variation       3933..3934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:377610395"
     variation       3939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780857425"
     variation       3944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414319373"
     variation       3947..3949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:546902781"
     variation       3947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206085009"
     variation       3949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466769406"
     variation       3955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645817287"
     variation       3956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320079218"
     variation       3959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645817432"
     variation       3960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726946"
     variation       3961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645817503"
     variation       3962..3966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1645817555"
     variation       3963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645817611"
     variation       3964
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485906"
     variation       3965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11544095"
     variation       3967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1645817850"
     variation       3968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645817948"
     variation       3968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039642957"
     variation       3969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911246481"
     variation       3974
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645818052"
     variation       3975
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645818125"
     variation       3976
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218478003"
     variation       3978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1383747021"
     variation       3981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645818278"
     variation       3988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474000510"
     variation       3991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544171570"
     variation       3992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645818496"
     variation       3993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645818573"
     variation       3996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210403066"
     variation       3998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267025830"
     variation       4000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645818774"
     variation       4001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941259690"
     variation       4002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210045144"
     variation       4010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557625954"
     variation       4011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998653464"
     variation       4016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726995"
     variation       4020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419147558"
     variation       4021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051283965"
     variation       4025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645819124"
     variation       4030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574493933"
     variation       4031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645819228"
     variation       4033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645819305"
     variation       4034..4040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aga"
                     /replace="agaga"
                     /replace="agagaga"
                     /db_xref="dbSNP:1408443115"
     variation       4034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541523978"
     variation       4035
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645819519"
     variation       4040..4048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaacaaaa"
                     /db_xref="dbSNP:1645819640"
     variation       4040..4043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148727018"
     variation       4040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1158708063"
     variation       4045..4048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1410026095"
     variation       4046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645819731"
     variation       4049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645819774"
     variation       4050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896976019"
     variation       4053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172827157"
     variation       4059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401165263"
     variation       4060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645819984"
     variation       4064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451767701"
     variation       4065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645820089"
     variation       4068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645820124"
     variation       4069..4070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1345756099"
     variation       4074
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334655869"
     variation       4075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004367048"
     variation       4077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219582033"
     variation       4082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287397808"
     variation       4087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645820515"
     variation       4091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372998612"
     variation       4094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017237893"
     variation       4097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645820656"
     variation       4101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373319406"
     variation       4103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645820760"
     variation       4104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229745842"
     variation       4105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268251248"
     variation       4111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645820953"
     variation       4112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645821031"
     variation       4114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645821074"
     variation       4115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727056"
     variation       4123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993969649"
     variation       4129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012596617"
     variation       4131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645821231"
     variation       4132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448552286"
     variation       4135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045604964"
     variation       4136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906930863"
     variation       4138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821420"
     variation       4141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821491"
     variation       4149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489048022"
     variation       4164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727077"
     variation       4165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645821607"
     variation       4166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181892531"
     variation       4172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557125243"
     variation       4175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821728"
     variation       4177..4178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1645821768"
     variation       4178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001311726"
     variation       4179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473677704"
     variation       4190..4194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1645822036"
     variation       4191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034417264"
     variation       4193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822170"
     variation       4194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413184561"
     variation       4195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382638"
     variation       4198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382641"
     variation       4202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957094857"
     variation       4203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011572868"
     variation       4207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645822564"
     variation       4208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822629"
     variation       4209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971191188"
     variation       4211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022507355"
     variation       4213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727119"
     variation       4215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756144267"
     variation       4216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645822899"
     variation       4222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822953"
     variation       4226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575345163"
     variation       4229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978201284"
     variation       4231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626132"
     variation       4233..4234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645823176"
     variation       4234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411307035"
     variation       4239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322270306"
     variation       4240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727135"
     variation       4246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924373359"
     variation       4247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203565985"
     variation       4251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922791500"
     variation       4257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645823580"
     variation       4260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645823649"
     variation       4261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727146"
     variation       4262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546120621"
     variation       4263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645823762"
     variation       4266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645823818"
     variation       4268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444486087"
     variation       4270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204943412"
     variation       4272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:564025142"
     variation       4274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727163"
     variation       4275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376079873"
     variation       4277..4293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcact"
                     /replace="ctgcactgtcctgcact"
                     /db_xref="dbSNP:1645824056"
     variation       4278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645824109"
     variation       4279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250105760"
     variation       4282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989931107"
     variation       4287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645824277"
     variation       4289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183169742"
     variation       4290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645824454"
     variation       4292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645824508"
     variation       4304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645824577"
     variation       4307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237116217"
     variation       4312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471885737"
     variation       4321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780741067"
     variation       4322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727183"
     variation       4325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576855548"
     variation       4328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645824874"
     variation       4331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541050685"
     variation       4333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727191"
     variation       4342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425259445"
     variation       4343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196156313"
     variation       4345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424382195"
     variation       4347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431327702"
     variation       4348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329204468"
     variation       4362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148727201"
     variation       4364..4369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtgt"
                     /replace="gtgtgt"
                     /db_xref="dbSNP:1645825345"
     variation       4364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943249793"
     variation       4373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749624548"
     variation       4375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645825509"
     variation       4377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921234759"
     variation       4385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645825620"
     variation       4388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571382858"
     variation       4395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645825732"
     variation       4398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382833814"
     variation       4406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933993252"
     variation       4407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645825989"
     variation       4411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645826036"
     variation       4413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645826076"
     variation       4416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344840620"
     variation       4418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1291821976"
     variation       4418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148727232"
     variation       4423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727237"
     variation       4426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645826237"
     variation       4427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206299477"
     variation       4428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051641159"
     variation       4438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645826361"
     variation       4451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440880750"
     variation       4452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559288072"
     variation       4459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404346706"
     variation       4460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645826631"
     variation       4461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645826690"
     variation       4463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238149641"
     variation       4466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645826756"
     variation       4467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571382930"
     variation       4468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1414972830"
     variation       4469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645826919"
     variation       4471..4472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645827004"
     variation       4471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382944"
     variation       4472..4473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645827093"
     variation       4472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199589770"
     variation       4473..4492
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /replace="ttttttttttttt"
                     /replace="tttttttttttttt"
                     /replace="tttttttttttttttttt"
                     /replace="ttttttttttttttttttt"
                     /replace="tttttttttttttttttttt"
                     /replace="ttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttttttt"
                     /db_xref="dbSNP:rs34158936"
     variation       4473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317317471"
     variation       4483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645827510"
     variation       4487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645827572"
     variation       4490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645827616"
     variation       4491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645827660"
     variation       4492..4493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /replace="ttttttttttttttg"
                     /db_xref="dbSNP:1645827744"
     variation       4492
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433708088"
     variation       4493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1324502726"
     variation       4493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645827857"
     variation       4493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78160010"
     variation       4494..4496
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148727293"
     variation       4495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80323450"
     variation       4497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttttttat"
                     /db_xref="dbSNP:1344308844"
     variation       4498..4508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gagacatgggg"
                     /db_xref="dbSNP:1571383009"
     variation       4498..4503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gagaca"
                     /db_xref="dbSNP:1645828118"
     variation       4498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221227537"
     variation       4499..4500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttt"
                     /db_xref="dbSNP:1571383021"
     variation       4499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264465139"
     variation       4500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828282"
     variation       4502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347685404"
     variation       4503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246135635"
     variation       4505..4508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gggg"
                     /db_xref="dbSNP:1201553074"
     variation       4508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383053"
     variation       4509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571383061"
     variation       4512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202415337"
     variation       4514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446323086"
     variation       4516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828685"
     variation       4518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828732"
     variation       4519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828797"
     variation       4520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828866"
     variation       4522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645828904"
     variation       4523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828946"
     variation       4524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038777167"
     variation       4526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645829095"
     variation       4527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206886008"
     variation       4529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887198165"
     variation       4531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383099"
     variation       4533..4534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1246165335"
     variation       4536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466173006"
     variation       4537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148727341"
     variation       4538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004418882"
     variation       4539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645829765"
     variation       4540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148727347"
     variation       4541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283953973"
     variation       4542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376878725"
     variation       4544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185636267"
     variation       4549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645830052"
     variation       4549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038514020"
     variation       4550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548345110"
     variation       4556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645830216"
     variation       4559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429539161"
     variation       4564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141020163"
     variation       4566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317924229"
     variation       4575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045574832"
     variation       4576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390154190"
     variation       4579..4584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccccc"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1264240367"
     variation       4579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907066780"
     variation       4582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531001823"
     variation       4583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1235875938"
     variation       4585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645830802"
     variation       4585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1480146316"
     variation       4587..4589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1571383214"
     variation       4587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645830860"
     variation       4591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001277575"
     variation       4595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197277733"
     variation       4596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379454699"
     variation       4597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022652520"
     variation       4599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157971224"
     variation       4600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1382485104"
     variation       4601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:971502052"
     variation       4602..4604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1205659617"
     variation       4603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298430299"
     variation       4604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552938102"
     variation       4605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645831457"
     variation       4606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266582286"
     variation       4607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645831573"
     variation       4608..4614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttttttt"
                     /db_xref="dbSNP:1364497161"
     variation       4614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645831800"
     variation       4619..4622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1645831867"
     variation       4621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002538732"
     variation       4623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031870725"
     variation       4624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472079739"
     variation       4626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955779820"
     variation       4631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302700761"
     variation       4637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383330"
     variation       4638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645832314"
     variation       4642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645832379"
     variation       4646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3767701"
     variation       4647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645832571"
     variation       4648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727431"
     variation       4652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645832655"
     variation       4655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413552657"
     variation       4657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453774936"
     variation       4660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163253086"
     variation       4666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535305390"
     variation       4667..4669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1645833042"
     variation       4669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1388934119"
     variation       4670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546631807"
     variation       4674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989942450"
     variation       4675..4685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gcctgggcttg"
                     /db_xref="dbSNP:1645833247"
     variation       4678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892881648"
     variation       4679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571383382"
     variation       4687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645833421"
     variation       4688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011206378"
     variation       4689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567921238"
     variation       4691
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966909637"
     variation       4693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914383203"
     variation       4696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383404"
     variation       4699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999755697"
     variation       4705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264842778"
     variation       4711..4712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645833861"
     variation       4713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354127015"
     variation       4715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645833991"
     variation       4720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529226907"
     variation       4727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224575972"
     variation       4728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727485"
     variation       4738
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11263837"
     variation       4740..4756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tggagg"
                     /replace="tggaggccagctggagg"
                     /db_xref="dbSNP:1482570994"
     variation       4741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955570714"
     variation       4747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834334"
     variation       4749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490230038"
     variation       4750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252219325"
     variation       4762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571383462"
     variation       4763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:985943795"
     variation       4766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147872657"
     variation       4768..4770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1367279967"
     variation       4776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645834800"
     variation       4778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834859"
     variation       4779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834930"
     variation       4783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645835003"
     variation       4787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575432473"
     variation       4792
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727526"
     variation       4793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164723063"
     variation       4796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626633"
     variation       4802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180986599"
     variation       4805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538396559"
     variation       4806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441473989"
     variation       4807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835457"
     variation       4811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645835540"
     variation       4812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835612"
     variation       4816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158965724"
     variation       4817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645835712"
     variation       4820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645835761"
     variation       4822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768629161"
     variation       4826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422319454"
     variation       4828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835966"
     variation       4829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539225992"
     variation       4838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390797034"
     variation       4839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645836125"
     variation       4845
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390373559"
     variation       4847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328762082"
     variation       4848..4854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atc"
                     /replace="atctatc"
                     /db_xref="dbSNP:1248093606"
     variation       4848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940048856"
     variation       4849..4851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1341276282"
     variation       4851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645836434"
     variation       4852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549478819"
     variation       4855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645836515"
     variation       4858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981391115"
     variation       4862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645836622"
     variation       4863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928450240"
     variation       4867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571383569"
     variation       4870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645836781"
     variation       4879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645836821"
     variation       4885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645836891"
     variation       4885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937119553"
     variation       4888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898638537"
     variation       4890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948854920"
     variation       4893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045068402"
     variation       4895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056043426"
     variation       4897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383595"
     variation       4900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002958675"
     variation       4901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374604719"
     variation       4903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891564764"
     variation       4909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645837338"
     variation       4911..4918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="catt"
                     /replace="cattcatt"
                     /db_xref="dbSNP:568286493"
     variation       4921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779127991"
     variation       4925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645837495"
     variation       4931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645837557"
     variation       4941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645837592"
     variation       4942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172946442"
     variation       4945..4949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taact"
                     /replace="taactaact"
                     /db_xref="dbSNP:763091191"
     variation       4948..4955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcct"
                     /replace="ctcctcct"
                     /db_xref="dbSNP:1465749168"
     variation       4948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301254589"
     variation       4949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404445156"
     variation       4950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566005717"
     variation       4951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645837930"
     variation       4969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557502697"
     variation       4973..4980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gctacagc"
                     /db_xref="dbSNP:1557626785"
     variation       4975
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776479735"
     variation       4977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267521187"
     variation       4981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838154"
     variation       4982
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838239"
     variation       4991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748073066"
     variation       4993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357140818"
     variation       4995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148920115"
     variation       4998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838456"
     variation       5000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041364990"
     variation       5001..5002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645838643"
     variation       5001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838592"
     variation       5002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838705"
     variation       5009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551183965"
     variation       5010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307814250"
     variation       5019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232095258"
     variation       5021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645838886"
     variation       5023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838928"
     variation       5029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838966"
     variation       5030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253817472"
     variation       5032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559700666"
     variation       5037..5038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1203738330"
     variation       5042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645839164"
     variation       5043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247992782"
     variation       5044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383731"
     variation       5047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179212155"
     variation       5048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974546690"
     variation       5054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645839412"
     variation       5055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645839464"
     variation       5056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999722784"
     variation       5061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029906678"
     variation       5065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574738407"
     variation       5066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432895085"
     variation       5067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891379793"
     variation       5070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645839882"
     variation       5071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174300866"
     variation       5083..5088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1030698125"
     variation       5087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954617636"
     variation       5094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645840096"
     variation       5099..5101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="act"
                     /db_xref="dbSNP:1645840140"
     variation       5100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645840201"
     variation       5102..5103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1645840255"
     variation       5103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645840310"
     variation       5106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319940523"
     variation       5108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645840847"
     variation       5109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749135264"
     variation       5110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987209249"
     variation       5115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626922"
     variation       5116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571383810"
     variation       5117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908518241"
     variation       5120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362408292"
     variation       5129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298812667"
     variation       5131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841240"
     variation       5134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940101447"
     variation       5137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645841340"
     variation       5138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841375"
     variation       5141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774314069"
     variation       5142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645841478"
     variation       5144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018878974"
     variation       5147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326383796"
     variation       5151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841621"
     variation       5152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:962811047"
     variation       5153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569028747"
     variation       5154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218561159"
     variation       5155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841805"
     variation       5157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974593532"
     variation       5166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243192888"
     variation       5167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488390585"
     variation       5172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727754"
     variation       5174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401866702"
     variation       5178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727758"
     variation       5185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727763"
     variation       5191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271378698"
     variation       5192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025644941"
     variation       5193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528581690"
     variation       5194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645842188"
     variation       5196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759576331"
     variation       5199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842281"
     variation       5201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842329"
     variation       5203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919992705"
     variation       5208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409869642"
     variation       5216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842477"
     variation       5218..5221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:948897736"
     variation       5218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645842520"
     variation       5220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161287709"
     variation       5221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382484440"
     variation       5222..5238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctaggatcagggcacta"
                     /replace="ctaggatcagggcactaggatcagggcacta"
                     /db_xref="dbSNP:1645842729"
     variation       5222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842691"
     variation       5224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345701651"
     variation       5226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142820733"
     variation       5230..5231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1645842850"
     variation       5236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435560919"
     variation       5238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645842923"
     variation       5242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11584551"
     variation       5243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301096853"
     variation       5244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347106387"
     variation       5245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843246"
     variation       5247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405193284"
     variation       5251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951399769"
     variation       5252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315279151"
     variation       5254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843426"
     variation       5257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843474"
     variation       5259..5260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1322495713"
     variation       5268..5270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645843565"
     variation       5270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148727824"
     variation       5274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044534109"
     variation       5275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285628921"
     variation       5281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226998190"
     variation       5282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645843752"
     variation       5283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384016"
     variation       5289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219960188"
     variation       5292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294435310"
     variation       5293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645843975"
     variation       5294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645844021"
     variation       5295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384041"
     variation       5296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844138"
     variation       5300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907449262"
     variation       5302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536462158"
     variation       5307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563614918"
     variation       5316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181737936"
     variation       5322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249885644"
     variation       5324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531160067"
     variation       5325..5334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttctctcctt"
                     /replace="ttctctccttctctcctt"
                     /db_xref="dbSNP:1645844480"
     variation       5327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844528"
     variation       5332..5334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctt"
                     /db_xref="dbSNP:1645844611"
     variation       5332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552823877"
     variation       5334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879655926"
     variation       5338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844688"
     variation       5340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404716895"
     variation       5341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161533657"
     variation       5343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367212903"
     variation       5344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425058234"
     variation       5346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844925"
     variation       5347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571384105"
     variation       5348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645845050"
     variation       5348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307085474"
     variation       5350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845099"
     variation       5353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727887"
     variation       5358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767735487"
     variation       5359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552050201"
     variation       5363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:528802065"
     variation       5373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443788207"
     variation       5374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845349"
     variation       5376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190099919"
     variation       5377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845472"
     variation       5380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256609372"
     variation       5381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845584"
     variation       5387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021369384"
     variation       5390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:947143594"
     variation       5396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645845708"
     variation       5397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182744550"
     variation       5398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571384166"
     variation       5404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204874862"
     variation       5405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845899"
     variation       5410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148727918"
     variation       5412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645845949"
     variation       5417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272814860"
     variation       5420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190613951"
     variation       5425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846085"
     variation       5431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846135"
     variation       5435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846189"
     variation       5436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151051297"
     variation       5441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205425860"
     variation       5444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465746348"
     variation       5445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172008691"
     variation       5447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384210"
     variation       5448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471812605"
     variation       5452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727946"
     variation       5455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405911669"
     variation       5459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645846538"
     variation       5460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902852262"
     variation       5461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645846623"
     variation       5462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645846660"
     variation       5464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:954806567"
     variation       5465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846742"
     variation       5467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983361467"
     variation       5473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645846852"
     variation       5479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645846900"
     variation       5480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645846957"
     variation       5482..5488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1645847010"
     variation       5494..5497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaga"
                     /db_xref="dbSNP:1645847063"
     variation       5499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148727972"
     variation       5505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167691315"
     variation       5507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847159"
     variation       5510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394022800"
     variation       5512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932947717"
     variation       5515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645847305"
     variation       5518..5520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ata"
                     /replace="atata"
                     /db_xref="dbSNP:1329050564"
     variation       5520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847415"
     variation       5521..5524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1358079609"
     variation       5524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772382251"
     variation       5525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550680342"
     variation       5528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384154969"
     variation       5530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645847733"
     variation       5531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961395198"
     variation       5533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847828"
     variation       5533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645847862"
     variation       5535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645847914"
     variation       5537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728004"
     variation       5552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847954"
     variation       5554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764511304"
     variation       5555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341839128"
     variation       5556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187348990"
     variation       5559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278180244"
     variation       5561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440823891"
     variation       5563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645848224"
     variation       5564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848273"
     variation       5570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970088425"
     variation       5572
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848359"
     variation       5573..5578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtg"
                     /replace="gtggtg"
                     /db_xref="dbSNP:1645848479"
     variation       5573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276597545"
     variation       5575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461734061"
     variation       5577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571384324"
     variation       5578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342434963"
     variation       5584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848655"
     variation       5588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219399290"
     variation       5596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539113284"
     variation       5597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980694120"
     variation       5598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371146862"
     variation       5599..5600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1645848996"
     variation       5599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891356896"
     variation       5600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645849048"
     variation       5601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401665842"
     variation       5605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310304736"
     variation       5609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849252"
     variation       5623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928789700"
     variation       5626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256324753"
     variation       5628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467820619"
     variation       5629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557539448"
     variation       5630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849521"
     variation       5632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148728056"
     variation       5634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754200663"
     variation       5635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645849600"
     variation       5636..5637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:749776818"
     variation       5645..5647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gtg"
                     /db_xref="dbSNP:1645849756"
     variation       5645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757754773"
     variation       5647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435029828"
     variation       5649..5650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1316774797"
     variation       5649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1320249981"
     variation       5651..5655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1328627531"
     variation       5651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849999"
     variation       5652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850105"
     variation       5653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850140"
     variation       5655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557627407"
     variation       5657..5661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ccccc"
                     /db_xref="dbSNP:1645850330"
     variation       5657..5661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:770805142"
     variation       5657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018434015"
     variation       5659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645850511"
     variation       5661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:898696084"
     variation       5664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645850599"
     variation       5665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274532947"
     variation       5668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41308339"
     variation       5673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645850811"
     variation       5680..5682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1645850893"
     variation       5680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850851"
     variation       5682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225535156"
     variation       5684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477947563"
     variation       5685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025695548"
     variation       5687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197997922"
     variation       5689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263862850"
     variation       5692
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:951451722"
     variation       5694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851215"
     variation       5697
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328507462"
     variation       5698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645851305"
     variation       5702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002846536"
     variation       5714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204485880"
     variation       5715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035711401"
     variation       5716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426622329"
     variation       5717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645851511"
     variation       5722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448579369"
     variation       5723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851605"
     variation       5726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851648"
     variation       5731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728166"
     variation       5733..5735
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1193605967"
     variation       5733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958630214"
     variation       5737
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851808"
     variation       5741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479270221"
     variation       5748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728182"
     variation       5749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1178071830"
     variation       5750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645851930"
     variation       5756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851973"
     variation       5760
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042669059"
     variation       5762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456242492"
     variation       5765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852094"
     variation       5767..5770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:759259838"
     variation       5767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852142"
     variation       5770..5781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgcttgcttgct"
                     /replace="tgcttgcttgcttgct"
                     /db_xref="dbSNP:900265053"
     variation       5770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645852241"
     variation       5771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645852361"
     variation       5775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401689084"
     variation       5778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852451"
     variation       5779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191912446"
     variation       5781..5782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tgctggcc"
                     /db_xref="dbSNP:1553157487"
     variation       5782..5789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggcc"
                     /replace="ggccggcc"
                     /replace="ggccggccggcc"
                     /db_xref="dbSNP:1296575768"
     variation       5783..5797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gccggcctgcctgcc"
                     /replace="gccggcctgcctgccggcctgcctgcc"
                     /db_xref="dbSNP:1362617855"
     variation       5783..5793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gccggcctgcc"
                     /replace="gccggcctgccggcctgcc"
                     /db_xref="dbSNP:1645852668"
     variation       5784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852759"
     variation       5785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914403513"
     variation       5786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968992815"
     variation       5787..5819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcctgcctgcctg"
                     /replace="gcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     g"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     gcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     gcctgcctg"
                     /db_xref="dbSNP:rs372821782"
     variation       5787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282666371"
     variation       5789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645853224"
     variation       5790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1365616037"
     variation       5790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:977225175"
     variation       5791..5797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcctgcc"
                     /replace="gcctgccggcctgcc"
                     /db_xref="dbSNP:747270933"
     variation       5791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426944064"
     variation       5793..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1571384632"
     variation       5793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301971013"
     variation       5794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370162251"
     variation       5795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389789240"
     variation       5797..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcctgcctgcctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgcctgcctgcctgtctgcctgcctgcctgcctgcctgt
                     ctgcct"
                     /db_xref="dbSNP:1645853684"
     variation       5798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645853731"
     variation       5801..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgcctgcctgtctgcctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1645853771"
     variation       5802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1316118886"
     variation       5803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309282984"
     variation       5804
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645854320"
     variation       5805..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1336375849"
     variation       5807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384653"
     variation       5808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963254787"
     variation       5809..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgtctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1237611797"
     variation       5811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645854627"
     variation       5812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555364099"
     variation       5813..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgtctgcct"
                     /replace="ctgcctgtctgcctgtctgcct"
                     /db_xref="dbSNP:1287917302"
     variation       5813
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292098066"
     variation       5814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645854848"
     variation       5815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645854897"
     variation       5816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557627632"
     variation       5817..5828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctgtctgcctat"
                     /db_xref="dbSNP:1252062550"
     variation       5817..5823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgtctg"
                     /replace="ctgtctgtctg"
                     /db_xref="dbSNP:200133723"
     variation       5817..5819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgactg"
                     /db_xref="dbSNP:1553157504"
     variation       5819..5820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:770398111"
     variation       5820..5821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1645855334"
     variation       5820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112770520"
     variation       5821..5826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcct"
                     /db_xref="dbSNP:1183589156"
     variation       5822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645855424"
     variation       5823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571445890"
     variation       5825
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645855513"
     variation       5842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645855558"
     variation       5844
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645855603"
     variation       5849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383916478"
     variation       5853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051361821"
     variation       5857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164574343"
     variation       5858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645855799"
     variation       5864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389894962"
     variation       5866
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221324706"
     variation       5871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026961947"
     variation       5873
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910240712"
     variation       5876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395510442"
     variation       5877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942960160"
     variation       5879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757921944"
     variation       5880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489203442"
     variation       5884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1380448830"
     variation       5885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193414679"
     variation       5886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384799"
     variation       5888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775414815"
     variation       5890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645856560"
     variation       5892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315494134"
     variation       5893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898752248"
     variation       5894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224797571"
     variation       5899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:928691509"
     variation       5900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202463972"
     variation       5901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996046803"
     variation       5904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645856886"
     variation       5905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148728410"
     variation       5907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419008182"
     variation       5910..5911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1241877536"
     variation       5910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463077268"
     variation       5911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047275375"
     variation       5912
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857163"
     variation       5914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184703413"
     variation       5917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:887166316"
     variation       5918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427104575"
     variation       5920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002980449"
     variation       5925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420492800"
     variation       5933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857445"
     variation       5942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645857490"
     variation       5944..5945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645857539"
     variation       5945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645857582"
     variation       5948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857646"
     variation       5952
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302816968"
     variation       5955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035677605"
     variation       5960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913494355"
     variation       5961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728446"
     variation       5962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645857860"
     variation       5964
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857900"
     variation       5971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557627845"
     variation       5980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645857980"
     variation       5987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571384916"
     variation       5988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174403877"
     variation       5996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762492099"
     variation       6001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958990209"
     variation       6002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779696256"
     variation       6004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337231783"
     variation       6010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380300635"
     variation       6014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645858678"
     variation       6017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297341203"
     variation       6018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307689490"
     variation       6023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947601773"
     variation       6027
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260732717"
     variation       6033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645859042"
     variation       6036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645859089"
     variation       6041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324999845"
     variation       6043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204871772"
     variation       6048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1438787912"
     variation       6051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645859379"
     variation       6053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021921367"
     variation       6054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968671573"
     variation       6062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763849097"
     variation       6064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645859555"
     variation       6067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042724086"
     variation       6068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645859650"
     variation       6069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645859708"
     variation       6070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567274274"
     variation       6085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661619"
     variation       6086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150347120"
     variation       6090..6094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1431544208"
     variation       6093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987216748"
     variation       6094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546276346"
     variation       6095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470343952"
     variation       6097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910216586"
     variation       6102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344515647"
     variation       6117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860254"
     variation       6123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192229737"
     variation       6126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290445387"
     variation       6127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362339452"
     variation       6133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403969851"
     variation       6137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860504"
     variation       6138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1244761611"
     variation       6138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287368967"
     variation       6140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037381878"
     variation       6145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645860681"
     variation       6149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148728519"
     variation       6151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1280900615"
     variation       6155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860783"
     variation       6162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346907933"
     variation       6163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920145968"
     variation       6164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645860929"
     variation       6172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528689854"
     variation       6174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645861030"
     variation       6175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284226539"
     variation       6177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931573500"
     variation       6179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315693552"
     variation       6180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540957769"
     variation       6191..6194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1221573684"
     variation       6192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645861365"
     variation       6197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368046981"
     variation       6199..6208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gagaa"
                     /replace="gagaagagaa"
                     /db_xref="dbSNP:1645861470"
     variation       6203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490268876"
     variation       6209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231826043"
     variation       6211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457670138"
     variation       6213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220619177"
     variation       6215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271306211"
     variation       6222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047241439"
     variation       6226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004756207"
     variation       6229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645861848"
     variation       6236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405839722"
     variation       6244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769653660"
     variation       6251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645861970"
     variation       6264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417265705"
     variation       6266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148728576"
     variation       6273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161126832"
     variation       6275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360937850"
     variation       6277..6281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gatcc"
                     /replace="gatccgatcc"
                     /db_xref="dbSNP:1645862149"
     variation       6286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562224713"
     variation       6288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899097755"
     variation       6291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002947890"
     variation       6293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057471908"
     variation       6297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645862459"
     variation       6301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645862508"
     variation       6303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138074007"
     variation       6304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645862610"
     variation       6312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645862666"
     variation       6314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440747757"
     variation       6317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645862778"
     variation       6318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162890296"
     variation       6322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645862869"
     variation       6328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894562681"
     variation       6330
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754406043"
     variation       6332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728607"
     variation       6337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772201195"
     variation       6341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148728609"
     variation       6354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645863100"
     variation       6355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645863154"
     variation       6356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021640249"
     variation       6362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141089342"
     variation       6363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998758461"
     variation       6364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1244212532"
     variation       6364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294278586"
     variation       6366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490584781"
     variation       6367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960365327"
     variation       6368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775545090"
     variation       6369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481620700"
     variation       6371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568795494"
     variation       6373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380815145"
     variation       6374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645863841"
     variation       6378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987268068"
     variation       6386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443819358"
     variation       6389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144915813"
     variation       6391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571385299"
     variation       6392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864076"
     variation       6394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864138"
     variation       6395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1377348939"
     variation       6396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645864227"
     variation       6402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374706238"
     variation       6403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113615155"
     variation       6405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864372"
     variation       6410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645864425"
     variation       6411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1282216452"
     variation       6417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645864544"
     variation       6418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645864590"
     variation       6421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405605719"
     variation       6423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645864668"
     variation       6425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380813945"
     variation       6427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:973456920"
     variation       6428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728666"
     variation       6429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864840"
     variation       6430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645864882"
     variation       6432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760929529"
     variation       6435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551057779"
     variation       6438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645865280"
     variation       6439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332689680"
     variation       6441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114256824"
     variation       6442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197273641"
     variation       6444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645865489"
     variation       6446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184309288"
     variation       6458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983063796"
     variation       6462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260624813"
     variation       6463..6467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1645865803"
     variation       6465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458613385"
     variation       6467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645865916"
     variation       6468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922161015"
     variation       6474..6482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:370557448"
     variation       6474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309399501"
     variation       6480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866192"
     variation       6481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866233"
     variation       6482..6483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:1645866326"
     variation       6482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987536748"
     variation       6483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187213249"
     variation       6484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385436"
     variation       6485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236111557"
     variation       6486..6488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:911645288"
     variation       6489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473876167"
     variation       6493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181616122"
     variation       6498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940409522"
     variation       6505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472999025"
     variation       6508..6509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1167019359"
     variation       6508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866716"
     variation       6509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1182705289"
     variation       6513..6518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gggcag"
                     /db_xref="dbSNP:1645866894"
     variation       6515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036208175"
     variation       6520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571385482"
     variation       6525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645867033"
     variation       6526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728745"
     variation       6527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555660904"
     variation       6529..6535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="act"
                     /replace="actgact"
                     /db_xref="dbSNP:1422983575"
     variation       6529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404662978"
     variation       6531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867197"
     variation       6535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1451113438"
     variation       6536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339192698"
     variation       6538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341515389"
     variation       6541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430446901"
     variation       6544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464188223"
     variation       6546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645867423"
     variation       6549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867458"
     variation       6552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645867490"
     variation       6553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364387032"
     variation       6560
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867572"
     variation       6564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572628298"
     variation       6567..6568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1201765786"
     variation       6571
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645867751"
     variation       6575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930444612"
     variation       6577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645867836"
     variation       6584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045041411"
     variation       6585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530603610"
     variation       6592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78530614"
     variation       6593..6594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1476204564"
     variation       6593
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645868037"
     variation       6594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894522255"
     variation       6596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776882598"
     variation       6601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868215"
     variation       6603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645868270"
     variation       6605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448255656"
     variation       6608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269278192"
     variation       6609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948849183"
     variation       6612..6613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645868454"
     variation       6615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868500"
     variation       6616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762170192"
     variation       6618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043438858"
     variation       6621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868671"
     variation       6622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385608"
     variation       6626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403509038"
     variation       6627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645868786"
     variation       6629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868819"
     variation       6633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904567735"
     variation       6641..6642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1400592274"
     variation       6642..6649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tca"
                     /replace="tcatctca"
                     /db_xref="dbSNP:1219867000"
     variation       6642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645868959"
     variation       6644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645869071"
     variation       6645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645869125"
     variation       6647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645869167"
     variation       6648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765675340"
     variation       6649..6651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1328506458"
     variation       6652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571385649"
     variation       6656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319157924"
     variation       6660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1343778835"
     variation       6663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557084074"
     variation       6671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036062361"
     variation       6673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276584304"
     variation       6678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895920140"
     variation       6680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276910052"
     variation       6681..6682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645869877"
     variation       6681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575661209"
     variation       6682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645869937"
     variation       6683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645869988"
     variation       6686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010249007"
     variation       6688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:2148728856"
     variation       6688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645870081"
     variation       6689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020314191"
     variation       6690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546362220"
     variation       6699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1479199859"
     variation       6701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645870356"
     variation       6703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890382760"
     variation       6704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008657978"
     variation       6707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763548820"
     variation       6711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157272761"
     variation       6713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645870598"
     variation       6714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953725615"
     variation       6718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645870679"
     variation       6719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964799598"
     variation       6722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302826706"
     variation       6729
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645870815"
     variation       6732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973205940"
     variation       6739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911516959"
     variation       6740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645870970"
     variation       6743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195863102"
     variation       6745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424452573"
     variation       6749..6754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1477632037"
     variation       6749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940323449"
     variation       6752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920339228"
     variation       6755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355662531"
     variation       6758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170784368"
     variation       6759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930497110"
     variation       6766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571385821"
     variation       6769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645871464"
     variation       6770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645871530"
     variation       6775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1290634553"
     variation       6777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645871697"
     variation       6777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558270328"
     variation       6778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211203653"
     variation       6781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044886782"
     variation       6784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138767681"
     variation       6787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939242447"
     variation       6793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950401389"
     variation       6796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185440121"
     variation       6798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057145760"
     variation       6800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872395"
     variation       6801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895835109"
     variation       6803..6807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1440738836"
     variation       6806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571385873"
     variation       6815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879157668"
     variation       6817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872617"
     variation       6825
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872675"
     variation       6833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645872766"
     variation       6835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872813"
     variation       6838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645872840"
     variation       6841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163376199"
     variation       6842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645872979"
     variation       6843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983116176"
     variation       6846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383722185"
     variation       6847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908759750"
     variation       6849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728950"
     variation       6850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728953"
     variation       6851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540494493"
     variation       6852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395952822"
     variation       6854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645873310"
     variation       6858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904610426"
     variation       6859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385919"
     variation       6862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148728967"
     variation       6865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1326832455"
     variation       6868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371613930"
     variation       6872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645873813"
     variation       6873
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447359167"
     variation       6874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10159166"
     variation       6876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953666043"
     variation       6877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385961"
     variation       6879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344366892"
     variation       6880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874205"
     variation       6884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916104249"
     variation       6886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874331"
     variation       6888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874374"
     variation       6897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874429"
     variation       6898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373746606"
     variation       6900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265650361"
     variation       6902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1009590328"
     variation       6904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645874686"
     variation       6905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544844168"
     variation       6911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386002"
     variation       6914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375483845"
     variation       6915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645874945"
     variation       6916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1458625794"
     variation       6917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019173380"
     variation       6918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875109"
     variation       6919
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875195"
     variation       6921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273645163"
     variation       6922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875305"
     variation       6925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165828405"
     variation       6927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875441"
     variation       6929
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746073637"
     variation       6930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645875572"
     variation       6933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645875655"
     variation       6934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875707"
     variation       6936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460567228"
     variation       6945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875815"
     variation       6946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645875867"
     variation       6948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875920"
     variation       6951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645875969"
     variation       6953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876036"
     variation       6959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169758238"
     variation       6960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:961745768"
     variation       6965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562192835"
     variation       6966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1043187507"
     variation       6970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904619927"
     variation       6976
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380376895"
     variation       6985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729053"
     variation       6995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645876532"
     variation       7000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397538632"
     variation       7004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876620"
     variation       7007..7009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1313037150"
     variation       7013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876714"
     variation       7014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487402670"
     variation       7015
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876817"
     variation       7017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645876859"
     variation       7019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920349220"
     variation       7023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148729069"
     variation       7026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645876981"
     variation       7029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121299"
     variation       7030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645877127"
     variation       7034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729074"
     variation       7036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532756658"
     variation       7040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645877237"
     variation       7042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551094472"
     variation       7048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645877341"
     variation       7049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645877397"
     variation       7051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645877438"
     variation       7052..7053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1645877485"
     variation       7053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877531"
     variation       7055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053063998"
     variation       7058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645877620"
     variation       7069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371449404"
     variation       7073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980648055"
     variation       7078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317917409"
     variation       7083
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645877810"
     variation       7088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203660652"
     variation       7091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877886"
     variation       7093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1263954548"
     variation       7093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877939"
     variation       7100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484473665"
     variation       7101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182776319"
     variation       7103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878184"
     variation       7106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890351554"
     variation       7107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748582631"
     variation       7108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451154583"
     variation       7122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878407"
     variation       7124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426972330"
     variation       7129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645878525"
     variation       7132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386195"
     variation       7133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196028282"
     variation       7134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645878800"
     variation       7136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008842113"
     variation       7138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878921"
     variation       7141..7146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:926420699"
     variation       7141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645878969"
     variation       7156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379364534"
     variation       7158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186734072"
     variation       7164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755885015"
     variation       7166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467484723"
     variation       7172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645879289"
     variation       7174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913819772"
     variation       7179..7184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agc"
                     /replace="agcagc"
                     /db_xref="dbSNP:2148729156"
     variation       7181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:527357395"
     variation       7182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:900365728"
     variation       7188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157779349"
     variation       7190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946087269"
     variation       7191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645879642"
     variation       7193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378292176"
     variation       7195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222356299"
     variation       7198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645879833"
     variation       7199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645879888"
     variation       7203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729179"
     variation       7204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777420444"
     variation       7205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314501170"
     variation       7206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880056"
     variation       7208..7210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctc"
                     /db_xref="dbSNP:1645880102"
     variation       7210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041669384"
     variation       7223
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386294"
     variation       7224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645880326"
     variation       7225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880377"
     variation       7229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645880421"
     variation       7234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645880469"
     variation       7238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880596"
     variation       7246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645880650"
     variation       7257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639867973"
     variation       7258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558373845"
     variation       7259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904621610"
     variation       7264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485093351"
     variation       7267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219140446"
     variation       7278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000206497"
     variation       7282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729205"
     variation       7283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772267788"
     variation       7285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027366153"
     variation       7288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197401612"
     variation       7294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729212"
     variation       7296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889305740"
     variation       7297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749293608"
     variation       7298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645881473"
     variation       7300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645881534"
     variation       7316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176622861"
     variation       7319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363083094"
     variation       7321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:548918631"
     variation       7325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019646938"
     variation       7326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004521790"
     variation       7332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324961860"
     variation       7335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360735202"
     variation       7336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1333275975"
     variation       7337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567411609"
     variation       7348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369010287"
     variation       7349..7352
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgta"
                     /replace="tgtatgta"
                     /db_xref="dbSNP:1442309469"
     variation       7350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220376437"
     variation       7353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882353"
     variation       7354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770825835"
     variation       7355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882492"
     variation       7356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027300752"
     variation       7357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287140063"
     variation       7362..7363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:1490253808"
     variation       7363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645882705"
     variation       7366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951788921"
     variation       7371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980959266"
     variation       7376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488846783"
     variation       7379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352008025"
     variation       7380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882980"
     variation       7381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645883030"
     variation       7383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249705353"
     variation       7384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645883150"
     variation       7389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544330785"
     variation       7392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645883275"
     variation       7394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645883329"
     variation       7396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413972925"
     variation       7402..7403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645883489"
     variation       7402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:960864590"
     variation       7407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537750959"
     variation       7409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993129847"
     variation       7411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916062408"
     variation       7412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351170931"
     variation       7415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645883831"
     variation       7417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149237486"
     variation       7419..7423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="catca"
                     /db_xref="dbSNP:913831161"
     variation       7419..7420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="cagca"
                     /db_xref="dbSNP:539061324"
     variation       7421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144443110"
     variation       7422..7444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cagcagcagca"
                     /replace="cagcagcagcagca"
                     /replace="cagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagcagcagca"
                     /db_xref="dbSNP:rs889197162"
     variation       7422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355722293"
     variation       7423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203872063"
     variation       7424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575056563"
     variation       7428..7429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttgttgt"
                     /db_xref="dbSNP:1269588845"
     variation       7431..7432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctatggct"
                     /db_xref="dbSNP:1452072720"
     variation       7433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1177987270"
     variation       7437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456405949"
     variation       7440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1645885688"
     variation       7440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645885640"
     variation       7442..7443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gcggc"
                     /db_xref="dbSNP:1645885789"
     variation       7442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180372984"
     variation       7445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645885837"
     variation       7446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645885889"
     variation       7450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645885938"
     variation       7451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148729327"
     variation       7452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934766659"
     variation       7459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645886069"
     variation       7461..7463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1645886176"
     variation       7461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645886118"
     variation       7462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645886223"
     variation       7464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539822482"
     variation       7465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645886321"
     variation       7467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645886384"
     variation       7469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729344"
     variation       7470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191490961"
     variation       7471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645886496"
     variation       7472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645886526"
     variation       7473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147996549"
     variation       7478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534259020"
     variation       7479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944611441"
     variation       7480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571386624"
     variation       7481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645886834"
     variation       7484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386633"
     variation       7485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1367463573"
     variation       7486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645887018"
     variation       7487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184023415"
     variation       7492
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574175798"
     variation       7493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544618983"
     variation       7495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571386676"
     variation       7499..7503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tctct"
                     /db_xref="dbSNP:1645887327"
     variation       7503..7511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /db_xref="dbSNP:rs796351016"
     variation       7509..7510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148729387"
     variation       7510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645887490"
     variation       7511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867387436"
     variation       7512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390866641"
     variation       7519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571386715"
     variation       7520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286216662"
     variation       7521..7524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148729393"
     variation       7521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188911199"
     variation       7526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645887831"
     variation       7529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1214158289"
     variation       7532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256255072"
     variation       7533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645887970"
     variation       7537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645888019"
     variation       7538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960456203"
     variation       7542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645888120"
     variation       7544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048938605"
     variation       7546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182195447"
     variation       7550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577246142"
     variation       7551
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645888320"
     variation       7552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645888365"
     variation       7558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004657513"
     variation       7561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207790449"
     variation       7576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238937216"
     variation       7584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472929518"
     variation       7588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645888623"
     variation       7589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645888676"
     variation       7590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770258663"
     variation       7594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645889020"
     variation       7595..7596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1420923125"
     variation       7595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034669992"
     variation       7598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172080513"
     variation       7604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960444785"
     variation       7612..7615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tcat"
                     /db_xref="dbSNP:1413226399"
     variation       7615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336586532"
     variation       7618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979339120"
     variation       7622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430287896"
     variation       7624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276524536"
     variation       7625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340047651"
     variation       7626..7627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746001460"
     variation       7627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:925197893"
     variation       7631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571386829"
     variation       7636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267273030"
     variation       7638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219290317"
     variation       7641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645889940"
     variation       7643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282674801"
     variation       7648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890236"
     variation       7652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645890277"
     variation       7655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645890320"
     variation       7659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344247107"
     variation       7661..7664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1645890475"
     variation       7661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773678037"
     variation       7663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645890524"
     variation       7664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280477276"
     variation       7667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645890662"
     variation       7668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442783041"
     variation       7674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197921213"
     variation       7675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986114472"
     variation       7677
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890878"
     variation       7679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890925"
     variation       7680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260563689"
     variation       7686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891060"
     variation       7695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891097"
     variation       7701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645891142"
     variation       7703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489008222"
     variation       7704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763601554"
     variation       7705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766939124"
     variation       7707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477336117"
     variation       7711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645891407"
     variation       7713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1178959666"
     variation       7714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255242825"
     variation       7717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891545"
     variation       7718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023183515"
     variation       7720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189238389"
     variation       7731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645891676"
     variation       7736
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891738"
     variation       7739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296624955"
     variation       7740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891932"
     variation       7741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970729207"
     variation       7743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978931276"
     variation       7747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185476341"
     variation       7749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645892133"
     variation       7751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645892172"
     variation       7754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645892214"
     variation       7755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956112691"
     variation       7756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477240493"
     variation       7757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759023126"
     variation       7763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645892407"
     variation       7764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302643848"
     variation       7774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645892494"
     variation       7776..7780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatga"
                     /db_xref="dbSNP:2148729521"
     variation       7777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645892547"
     variation       7778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911887757"
     variation       7779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898025322"
     variation       7782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661620"
     variation       7783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049380833"
     variation       7787..7789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gga"
                     /replace="ggagga"
                     /db_xref="dbSNP:1645892854"
     variation       7787..7788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:764616411"
     variation       7788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239124372"
     variation       7792..7793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645892937"
     variation       7796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283570239"
     variation       7798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039451250"
     variation       7802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921842803"
     variation       7803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893134"
     variation       7805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355436608"
     variation       7806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527401943"
     variation       7809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467667265"
     variation       7810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893334"
     variation       7813..7815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:71573710"
     variation       7821..7823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1201704138"
     variation       7823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893459"
     variation       7830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048906465"
     variation       7835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1299064106"
     variation       7838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247766098"
     variation       7839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549014350"
     variation       7841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157249630"
     variation       7843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752455063"
     variation       7848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645893821"
     variation       7852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394491176"
     variation       7859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888029350"
     variation       7860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141708021"
     variation       7871..7877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggag"
                     /replace="ggaggag"
                     /db_xref="dbSNP:1330261261"
     variation       7874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896232710"
     variation       7876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387090"
     variation       7884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645894291"
     variation       7888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387095"
     variation       7888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645894397"
     variation       7894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645894441"
     variation       7898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388570987"
     variation       7899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645894524"
     variation       7903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011886579"
     variation       7904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325493005"
     variation       7911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033313595"
     variation       7912
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218020464"
     variation       7918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023742547"
     variation       7920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906099748"
     variation       7923
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896245769"
     variation       7926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645895127"
     variation       7927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013363402"
     variation       7930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645895229"
     variation       7931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353691617"
     variation       7933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000435153"
     variation       7934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529304195"
     variation       7935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542691451"
     variation       7937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645895540"
     variation       7940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645895647"
     variation       7940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:988939718"
     variation       7944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979226030"
     variation       7945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018993608"
     variation       7949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645895806"
     variation       7951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645895843"
     variation       7953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183272091"
     variation       7958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032227537"
     variation       7959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11800878"
     variation       7962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367583172"
     variation       7963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753609764"
     variation       7964
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465046339"
     variation       7966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645896209"
     variation       7968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329223357"
     variation       7971..7973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1645896334"
     variation       7971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645896294"
     variation       7981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645896399"
     variation       7982
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378916834"
     variation       7983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190765482"
     variation       7985..7988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1645896590"
     variation       7985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311690893"
     variation       7986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984738697"
     variation       7988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729640"
     variation       7994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944691489"
     variation       8003
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729643"
     variation       8004..8006
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1256497507"
     variation       8004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487758792"
     variation       8005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148729650"
     variation       8008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645897182"
     variation       8010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729652"
     variation       8017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645897231"
     variation       8018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976189008"
     variation       8020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645897326"
     variation       8025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190800512"
     variation       8028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115528846"
     variation       8029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197366841"
     variation       8031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260527645"
     variation       8036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551808585"
     variation       8037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200272100"
     variation       8039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645897780"
     variation       8042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897836"
     variation       8045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645897877"
     variation       8048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897924"
     variation       8051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897970"
     variation       8053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254452984"
     variation       8055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425796858"
     variation       8056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778783444"
     variation       8067..8071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:1423093406"
     variation       8068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645898281"
     variation       8069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:940472965"
     variation       8073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476877414"
     variation       8074
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645898453"
     variation       8076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049227178"
     variation       8077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402407879"
     variation       8084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909460062"
     variation       8085..8086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1557630020"
     variation       8085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302059480"
     variation       8086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1571387308"
     variation       8087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645898841"
     variation       8088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645898886"
     variation       8091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147293577"
     variation       8092..8094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1397482627"
     variation       8092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645898996"
     variation       8098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645899069"
     variation       8100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645899120"
     variation       8101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645899171"
     variation       8102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938255812"
     variation       8107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11263838"
     variation       8109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645899415"
     variation       8110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645899471"
     variation       8111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216218597"
     variation       8114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645899572"
     variation       8115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:663163"
     variation       8116..8117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttata"
                     /db_xref="dbSNP:1645899747"
     variation       8117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645899797"
     variation       8120..8122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645899845"
     variation       8122..8123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1013199093"
     variation       8125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042160042"
     variation       8131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645900020"
     variation       8137..8139
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1645900073"
     variation       8137..8138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:796743131"
     variation       8142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557630078"
     variation       8147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900249"
     variation       8149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1044725499"
     variation       8150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645900359"
     variation       8152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902232968"
     variation       8153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557630092"
     variation       8163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645900525"
     variation       8167..8171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1645900560"
     variation       8169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376232788"
     variation       8170..8181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagagaa"
                     /replace="aagagaagagaa"
                     /db_xref="dbSNP:1424350327"
     variation       8173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900712"
     variation       8174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000663554"
     variation       8179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900811"
     variation       8185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032148243"
     variation       8186..8187
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:1645900894"
     variation       8188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900937"
     variation       8189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729767"
     variation       8190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34764544"
     variation       8191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729770"
     variation       8192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:903552001"
     variation       8194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000404100"
     variation       8197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313153284"
     variation       8203..8205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1006832383"
     variation       8210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781125965"
     variation       8214
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645901266"
     variation       8220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397696222"
     variation       8221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748441732"
     variation       8222..8226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:966105029"
     variation       8222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892052895"
     variation       8227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645901541"
     variation       8233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342494143"
     variation       8241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314362355"
     variation       8244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645901702"
     variation       8248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919342755"
     variation       8249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645901799"
     variation       8256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645901848"
     variation       8263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010329201"
     variation       8266..8268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1557630174"
     variation       8268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215065727"
     variation       8269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769882762"
     variation       8271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387463"
     variation       8272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574185625"
     variation       8273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264075715"
     variation       8283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975260157"
     variation       8285..8291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttgttt"
                     /db_xref="dbSNP:1645902274"
     variation       8288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538411096"
     variation       8291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773731413"
     variation       8292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951987747"
     variation       8293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729816"
     variation       8294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645902459"
     variation       8295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280795884"
     variation       8296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729822"
     variation       8300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645902565"
     variation       8301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729825"
     variation       8306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265144990"
     variation       8307..8326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtaggagaagaaatcagagt"
                     /replace="gtaggagaagaaatcagagtgtaggagaagaaatcagagt"
                     /db_xref="dbSNP:1553157891"
     variation       8311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645902976"
     variation       8319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487736618"
     variation       8322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903083"
     variation       8323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749626639"
     variation       8325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417491401"
     variation       8325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:938167185"
     variation       8326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645903330"
     variation       8327..8334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1160082662"
     variation       8327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645903375"
     variation       8333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345332379"
     variation       8336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645903513"
     variation       8338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1214054853"
     variation       8346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645903616"
     variation       8350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907765237"
     variation       8354..8360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:1456950828"
     variation       8355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903841"
     variation       8358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903885"
     variation       8359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645903931"
     variation       8362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729859"
     variation       8365..8366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:371771654"
     variation       8368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571387555"
     variation       8369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904086"
     variation       8372..8377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1645904193"
     variation       8372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645904133"
     variation       8374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556310027"
     variation       8382..8383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1264683629"
     variation       8383..8385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148729868"
     variation       8383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904356"
     variation       8385..8393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:557690955"
     variation       8388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:577932548"
     variation       8389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904533"
     variation       8391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187611390"
     variation       8392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267197074"
     variation       8393..8395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1491398912"
     variation       8393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645904691"
     variation       8394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:375747906"
     variation       8394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431961690"
     variation       8395..8401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:949060752"
     variation       8396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771565242"
     variation       8397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645905040"
     variation       8398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396098897"
     variation       8400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419295127"
     variation       8401..8410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="ttttaccttt"
                     /db_xref="dbSNP:1645905198"
     variation       8405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645905238"
     variation       8407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042002877"
     variation       8413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645905349"
     variation       8414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286980669"
     variation       8415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321236834"
     variation       8419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645905480"
     variation       8427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645905516"
     variation       8429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219505196"
     variation       8430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571387653"
     variation       8432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1267249623"
     variation       8434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369684987"
     variation       8439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645905767"
     variation       8440..8443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1194112655"
     variation       8443..8445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1237414549"
     variation       8443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645905861"
     variation       8446..8457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gacttacttacg"
                     /db_xref="dbSNP:1645905983"
     variation       8447..8456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="acttac"
                     /replace="acttacttac"
                     /db_xref="dbSNP:750086957"
     variation       8447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906029"
     variation       8450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917773706"
     variation       8451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645906224"
     variation       8451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906185"
     variation       8455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1362524771"
     variation       8456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645906455"
     variation       8456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61555210"
     variation       8457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293016194"
     variation       8458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774945280"
     variation       8468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045258462"
     variation       8477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351045545"
     variation       8481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645906718"
     variation       8482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387722"
     variation       8483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565480687"
     variation       8484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182177708"
     variation       8488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331242413"
     variation       8495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906985"
     variation       8497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572003492"
     variation       8502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398619650"
     variation       8505..8508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:754918941"
     variation       8507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280462375"
     variation       8511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936305098"
     variation       8514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226766659"
     variation       8516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052060548"
     variation       8524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352780824"
     variation       8528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892022079"
     variation       8529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314948396"
     variation       8532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542039100"
     variation       8534..8539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cac"
                     /replace="caccac"
                     /db_xref="dbSNP:1645907567"
     variation       8535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645907624"
     variation       8536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645907679"
     variation       8541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645907731"
     variation       8542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571387811"
     variation       8548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040534105"
     variation       8551
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902042514"
     variation       8554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645907910"
     variation       8562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645907960"
     variation       8564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908010"
     variation       8566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387839"
     variation       8570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645908075"
     variation       8572..8577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aataaa"
                     /db_xref="dbSNP:1317146102"
     variation       8575..8583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaac"
                     /replace="aaacaaaac"
                     /db_xref="dbSNP:997523767"
     variation       8579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767123720"
     variation       8582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387863"
     variation       8587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387867"
     variation       8592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645908405"
     variation       8594..8601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tcctagcc"
                     /db_xref="dbSNP:1645908448"
     variation       8600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908497"
     variation       8603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatatta"
                     /db_xref="dbSNP:1645908602"
     variation       8603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029459149"
     variation       8609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387884"
     variation       8610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774834541"
     variation       8619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908777"
     variation       8620..8621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645908887"
     variation       8620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908816"
     variation       8621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233198421"
     variation       8622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645908978"
     variation       8623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645909028"
     variation       8625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730012"
     variation       8630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909071"
     variation       8636..8641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:1645909107"
     variation       8640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909150"
     variation       8648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762839218"
     variation       8649..8657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tattt"
                     /replace="tatttattt"
                     /db_xref="dbSNP:1179746891"
     variation       8650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909344"
     variation       8654..8655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1263195438"
     variation       8659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645909441"
     variation       8660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475235403"
     variation       8661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645909532"
     variation       8662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909578"
     variation       8663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909620"
     variation       8665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006202972"
     variation       8668..8674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:1170643933"
     variation       8672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645909760"
     variation       8673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387944"
     variation       8676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422145745"
     variation       8683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375451995"
     variation       8688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645909930"
     variation       8702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1014957927"
     variation       8705..8709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:909283444"
     variation       8706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961944436"
     variation       8711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196097951"
     variation       8712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645910202"
     variation       8712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645910166"
     variation       8715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645910251"
     variation       8718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253996075"
     variation       8720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992521972"
     variation       8721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910417"
     variation       8727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910458"
     variation       8728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910515"
     variation       8730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991359427"
     variation       8731..8732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1645910622"
     variation       8733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917757843"
     variation       8734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969590169"
     variation       8736
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218063131"
     variation       8739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439531364"
     variation       8744
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645911357"
     variation       8748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557630522"
     variation       8749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980636381"
     variation       8750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316018304"
     variation       8754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645911565"
     variation       8755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925003738"
     variation       8758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645911655"
     variation       8759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176998308"
     variation       8764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645911744"
     variation       8765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936440744"
     variation       8766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645911840"
     variation       8771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645911885"
     variation       8774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216184695"
     variation       8782..8783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645911975"
     variation       8784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273527169"
     variation       8785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645912066"
     variation       8786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645912107"
     variation       8788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645912153"
     variation       8792
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441615560"
     variation       8793..8796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1207643714"
     variation       8794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918185284"
     variation       8795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485770805"
     variation       8801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192327329"
     variation       8804
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949611226"
     variation       8808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479091509"
     variation       8809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977746888"
     variation       8810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645912933"
     variation       8811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168993980"
     variation       8815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401515206"
     variation       8820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645913138"
     variation       8821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571388106"
     variation       8823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645913242"
     variation       8829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:923632669"
     variation       8832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178558224"
     variation       8836
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645913385"
     variation       8841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185191307"
     variation       8842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1348252754"
     variation       8847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645913563"
     variation       8850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645913592"
     variation       8855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459362590"
     variation       8863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913598862"
     variation       8867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296441105"
     variation       8870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255355390"
     variation       8872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053574204"
     variation       8881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645914337"
     variation       8889..8890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tacatta"
                     /db_xref="dbSNP:1645914441"
     variation       8889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645914395"
     variation       8890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:946293747"
     variation       8891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cattatc"
                     /db_xref="dbSNP:1645914549"
     variation       8893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645914597"
     variation       8897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730137"
     variation       8900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645914643"
     variation       8901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571388164"
     variation       8905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344082505"
     variation       8907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041064870"
     variation       8908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645914949"
     variation       8916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148730146"
     variation       8917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902102576"
     variation       8922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348171002"
     variation       8925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041242279"
     variation       8930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260498192"
     variation       8936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645915204"
     variation       8940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488977942"
     variation       8942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996721403"
     variation       8944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246608446"
     variation       8950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645915401"
     variation       8956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050633707"
     variation       8960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645915497"
     variation       8961..8967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tggt"
                     /replace="tggtggt"
                     /db_xref="dbSNP:1645915544"
     variation       8963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372984594"
     variation       8966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193311041"
     variation       8967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311204694"
     variation       8971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645915762"
     variation       8976
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557630747"
     variation       8978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571388234"
     variation       8981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760427087"
     variation       8989
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025546631"
     variation       8992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419395934"
     variation       8994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561018703"
     variation       9001..9002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645916191"
     variation       9003
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362587577"
     variation       9011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916291"
     variation       9013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645916333"
     variation       9019..9029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttgttatttct"
                     /db_xref="dbSNP:886475700"
     variation       9023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763687211"
     variation       9025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016353899"
     variation       9030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531279755"
     variation       9042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:959688040"
     variation       9051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916654"
     variation       9052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645916697"
     variation       9061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916781"
     variation       9067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962078524"
     variation       9068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868779519"
     variation       9070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917001"
     variation       9072
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571388284"
     variation       9073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239056012"
     variation       9075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645917148"
     variation       9076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917198"
     variation       9078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025076280"
     variation       9080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287091044"
     variation       9087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917377"
     variation       9088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917438"
     variation       9092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917492"
     variation       9093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917535"
     variation       9099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323048375"
     variation       9100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917625"
     variation       9102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917669"
     variation       9106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917718"
     variation       9110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917769"
     variation       9113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917834"
     variation       9114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013592131"
     variation       9117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025276256"
     variation       9120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645918010"
     variation       9122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645918050"
     variation       9124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645918116"
     variation       9126..9132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttcctct"
                     /db_xref="dbSNP:1645918165"
     variation       9131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969343335"
     variation       9132..9147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tggaggccaagtgttg"
                     /db_xref="dbSNP:531097561"
     variation       9134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645918352"
     variation       9141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288469844"
     variation       9147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457711634"
     variation       9152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924187437"
     variation       9153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936380126"
     variation       9155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645918640"
     variation       9157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439445401"
     variation       9158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980987145"
     variation       9163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188289018"
     variation       9164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645918843"
     variation       9165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645918909"
     variation       9167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470605990"
     variation       9172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375321641"
     variation       9180..9182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1234983001"
     variation       9182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645919134"
     variation       9183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645919188"
     variation       9184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403601243"
     variation       9189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1327825640"
     variation       9190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910981528"
     variation       9191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645919439"
     variation       9192..9203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agccagccagcc"
                     /replace="agccagccagccagcc"
                     /db_xref="dbSNP:1181550295"
     variation       9193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411707007"
     variation       9195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557630912"
     variation       9198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957770044"
     variation       9200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645919705"
     variation       9202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942413140"
     variation       9204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337188989"
     variation       9206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040900849"
     variation       9209..9214
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1645919966"
     variation       9211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283098745"
     variation       9212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645920093"
     variation       9216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730297"
     variation       9217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353624234"
     variation       9222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1476268804"
     variation       9226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901028900"
     variation       9230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457678064"
     variation       9240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645920365"
     variation       9242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197180703"
     variation       9250..9254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ga"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:140864"
     variation       9250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645920503"
     variation       9251..9252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:34307163"
     variation       9252..9255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:35814364"
     variation       9252..9253
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="ga"
                     /db_xref="dbSNP:869263455"
     variation       9252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201441860"
     variation       9256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:550020187"
     variation       9258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438623533"
     variation       9259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047055048"
     variation       9260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888328294"
     variation       9268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921198"
     variation       9269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730337"
     variation       9273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1006231276"
     variation       9281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921275"
     variation       9283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645921336"
     variation       9286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181116037"
     variation       9288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921436"
     variation       9290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167074194"
     variation       9291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333074315"
     variation       9293..9294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645921609"
     variation       9294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645921660"
     variation       9295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016651001"
     variation       9296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645921779"
     variation       9298..9300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:555724154"
     variation       9298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756987293"
     variation       9299
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645921958"
     variation       9304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571388519"
     variation       9306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557631025"
     variation       9310
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012769642"
     variation       9311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730355"
     variation       9312..9313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:2148730356"
     variation       9313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987884081"
     variation       9314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391670109"
     variation       9320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550717064"
     variation       9321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025002346"
     variation       9327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333064396"
     variation       9328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730365"
     variation       9329..9334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:1645922504"
     variation       9329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970904019"
     variation       9331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730371"
     variation       9332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338243940"
     variation       9337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148730372"
     variation       9338..9342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agcag"
                     /db_xref="dbSNP:978227204"
     variation       9340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645922642"
     variation       9342..9346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1557631060"
     variation       9343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645922737"
     variation       9345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115162190"
     variation       9346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557631064"
     variation       9347..9348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1557631076"
     variation       9347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557631071"
     variation       9349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645922998"
     variation       9350..9359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggagga"
                     /replace="aggaggagga"
                     /db_xref="dbSNP:1645923047"
     variation       9357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317848508"
     variation       9358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645923174"
     variation       9360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958496568"
     variation       9362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1253510461"
     variation       9364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943662728"
     variation       9365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547713014"
     variation       9366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233292745"
     variation       9373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923581"
     variation       9376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923620"
     variation       9377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645923674"
     variation       9379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976459592"
     variation       9380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645923769"
     variation       9381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923803"
     variation       9382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188783541"
     variation       9388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923894"
     variation       9389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369522490"
     variation       9394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923987"
     variation       9399
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923494918"
     variation       9400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477460562"
     variation       9401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317790452"
     variation       9404..9405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1645924240"
     variation       9404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645924190"
     variation       9406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369678188"
     variation       9408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645924382"
     variation       9408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645924334"
     variation       9409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750425416"
     variation       9411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932276397"
     variation       9415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1399655616"
     variation       9421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645924654"
     variation       9421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645924616"
     variation       9423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910853352"
     variation       9428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730433"
     variation       9429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536927360"
     variation       9431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566794455"
     variation       9434..9435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1645924872"
     variation       9435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645924925"
     variation       9442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645924976"
     variation       9443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339261076"
     variation       9445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209679291"
     variation       9446..9452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aagttaa"
                     /db_xref="dbSNP:1645925240"
     variation       9446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942092258"
     variation       9450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645925297"
     variation       9451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925351"
     variation       9455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233011649"
     variation       9456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645925450"
     variation       9461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235883822"
     variation       9465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557631171"
     variation       9468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254587948"
     variation       9469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963726070"
     variation       9470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925755"
     variation       9471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211791579"
     variation       9473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925844"
     variation       9474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645925905"
     variation       9477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976524051"
     variation       9478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285469149"
     variation       9480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645926152"
     variation       9481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487344556"
     variation       9484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922346450"
     variation       9487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929800092"
     variation       9490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:527669622"
     variation       9491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549237039"
     variation       9493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197914771"
     variation       9495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730478"
     variation       9498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392976578"
     variation       9500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436265888"
     variation       9512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173872939"
     variation       9513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359389680"
     variation       9519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450967468"
     variation       9520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290064103"
     variation       9521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781379128"
     variation       9522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909814849"
     variation       9524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299657367"
     variation       9526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1373626613"
     variation       9531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645927187"
     variation       9534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185858553"
     variation       9550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055697473"
     variation       9552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661621"
     variation       9553..9562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tccttc"
                     /replace="tccttccttc"
                     /db_xref="dbSNP:1218081256"
     variation       9553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645927931"
     variation       9554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261319218"
     variation       9556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557631281"
     variation       9559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905089140"
     variation       9563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645928288"
     variation       9565
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476784105"
     variation       9567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928392"
     variation       9568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1209153186"
     variation       9569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002154199"
     variation       9573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250980066"
     variation       9575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148730511"
     variation       9592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730512"
     variation       9599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571388910"
     variation       9610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928633"
     variation       9614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928670"
     variation       9616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928707"
     variation       9620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169625706"
     variation       9621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557631302"
     variation       9625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928858"
     variation       9626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928897"
     variation       9627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755404281"
     variation       9630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379326027"
     variation       9633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566124661"
     variation       9639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906587405"
     variation       9640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645929464"
     variation       9644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957905671"
     variation       9645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987936386"
     variation       9648..9652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1324462378"
     variation       9649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645929665"
     variation       9652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397188131"
     variation       9653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645929760"
     variation       9655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442134509"
     variation       9657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308942244"
     variation       9659..9670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agcagaccccag"
                     /db_xref="dbSNP:1645929927"
     variation       9661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571388998"
     variation       9665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020633272"
     variation       9666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645930068"
     variation       9667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537918276"
     variation       9668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011597209"
     variation       9670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645930333"
     variation       9672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976807461"
     variation       9674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415042054"
     variation       9678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556344781"
     variation       9680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645930529"
     variation       9681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645930579"
     variation       9683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645930630"
     variation       9685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645930675"
     variation       9696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645930721"
     variation       9703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920968850"
     variation       9704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571457484"
     variation       9705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237268495"
     variation       9707..9710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1479460493"
     variation       9712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178560312"
     variation       9715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645931081"
     variation       9717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408159161"
     variation       9719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422693027"
     variation       9721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778071525"
     variation       9728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538991257"
     variation       9731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645931359"
     variation       9733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1420696197"
     variation       9740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462365726"
     variation       9741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337824283"
     variation       9743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976378557"
     variation       9749..9751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1353108129"
     variation       9750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645931650"
     variation       9752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76228984"
     variation       9761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645931822"
     variation       9763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730618"
     variation       9764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909469542"
     variation       9766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982632384"
     variation       9767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932004"
     variation       9772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571389116"
     variation       9773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932124"
     variation       9774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413035460"
     variation       9776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932222"
     variation       9777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909731645"
     variation       9779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645932343"
     variation       9782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932401"
     variation       9785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336859435"
     variation       9787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645932525"
     variation       9788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941191309"
     variation       9793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571976877"
     variation       9795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542631707"
     variation       9796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554236559"
     variation       9798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645932802"
     variation       9802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218947869"
     variation       9803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1276981531"
     variation       9814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206225660"
     variation       9815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:897878642"
     variation       9816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949518256"
     variation       9817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76697094"
     variation       9819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185171901"
     variation       9820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258936672"
     variation       9823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645933368"
     variation       9824
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475855058"
     variation       9825..9826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1170589272"
     variation       9826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148730672"
     variation       9826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645933797"
     variation       9827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417868148"
     variation       9828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389218"
     variation       9832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:905225551"
     variation       9838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002072883"
     variation       9847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487381167"
     variation       9849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934129"
     variation       9850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171506019"
     variation       9851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934252"
     variation       9853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934296"
     variation       9854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191561832"
     variation       9857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565124454"
     variation       9860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934495"
     variation       9869
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356152831"
     variation       9871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934617"
     variation       9877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242561591"
     variation       9878
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774855156"
     variation       9879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020767569"
     variation       9880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934928"
     variation       9892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396694608"
     variation       9893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965488511"
     variation       9894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999541063"
     variation       9895..9896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1273371065"
     variation       9895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052452213"
     variation       9898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208267090"
     variation       9900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645935320"
     variation       9901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281928751"
     variation       9903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645935416"
     variation       9908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997980288"
     variation       9916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645935522"
     variation       9924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144839878"
     variation       9926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645935647"
     variation       9932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953699800"
     variation       9940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777902193"
     variation       9947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645935888"
     variation       9948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389337"
     variation       9949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909436967"
     variation       9953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645936024"
     variation       9959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730732"
     variation       9960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936070"
     variation       9963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746430497"
     variation       9965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972205965"
     variation       9967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645936224"
     variation       9968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424826706"
     variation       9970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1433155202"
     variation       9974
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645936346"
     variation       9975
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936384"
     variation       9980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299430009"
     variation       9987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936481"
     variation       9992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:964296465"
     variation       9993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645936637"
     variation       9993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541373139"
     variation       9994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567471178"
     variation       9995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046513851"
     variation       9998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645936800"
     variation       10000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645936844"
     variation       10001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926702492"
     variation       10003
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936923"
     variation       10004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343372432"
     variation       10007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937979601"
     variation       10009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645937054"
     variation       10011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937090"
     variation       10013..10021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ta"
                     /replace="tatatcata"
                     /db_xref="dbSNP:1645937128"
     variation       10014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772438156"
     variation       10018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273415719"
     variation       10019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937280"
     variation       10021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951009828"
     variation       10024..10025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645937390"
     variation       10025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369976515"
     variation       10026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937485"
     variation       10028..10033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1373713883"
     variation       10033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183777566"
     variation       10038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235279035"
     variation       10040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893706036"
     variation       10041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938031"
     variation       10044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879287028"
     variation       10045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645938135"
     variation       10046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645938178"
     variation       10048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938223"
     variation       10049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571389448"
     variation       10050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376685024"
     variation       10051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285655950"
     variation       10052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557631682"
     variation       10055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009468975"
     variation       10058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775089595"
     variation       10060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645938531"
     variation       10061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938581"
     variation       10062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351784476"
     variation       10064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645938762"
     variation       10066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982558756"
     variation       10067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042607221"
     variation       10068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938928"
     variation       10071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645938968"
     variation       10073..10079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:1449247484"
     variation       10077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450922295"
     variation       10087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645939126"
     variation       10090
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1246555874"
     variation       10091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645939234"
     variation       10093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452924763"
     variation       10095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186821250"
     variation       10097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645939409"
     variation       10099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147529833"
     variation       10101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571389520"
     variation       10103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645939650"
     variation       10109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645939724"
     variation       10112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901047433"
     variation       10113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645940116"
     variation       10114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645940165"
     variation       10115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016676335"
     variation       10116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571389534"
     variation       10120..10125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1156913272"
     variation       10121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454602683"
     variation       10126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041723286"
     variation       10129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402447345"
     variation       10130..10133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1378038090"
     variation       10130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902424416"
     variation       10132..10133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1455044342"
     variation       10132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393521931"
     variation       10133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237809139"
     variation       10134..10152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttttttt"
                     /replace="ttttttttttttt"
                     /replace="ttttttttttttttt"
                     /replace="tttttttttttttttt"
                     /replace="ttttttttttttttttt"
                     /replace="tttttttttttttttttt"
                     /replace="ttttttttttttttttttt"
                     /replace="tttttttttttttttttttt"
                     /replace="ttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttttttttttttttttttttttt
                     ttttttt"
                     /db_xref="dbSNP:rs56299314"
     variation       10134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998430886"
     variation       10135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389444371"
     variation       10136..10137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1253963572"
     variation       10136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991298321"
     variation       10137..10138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645941577"
     variation       10137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941528"
     variation       10138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941619"
     variation       10139
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1305799231"
     variation       10140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437526799"
     variation       10141..10142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645941836"
     variation       10141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324541265"
     variation       10142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941887"
     variation       10144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373639324"
     variation       10147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442010437"
     variation       10151..10152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645942085"
     variation       10152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915821854"
     variation       10153..10154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1459750847"
     variation       10153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334151702"
     variation       10154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645942678"
     variation       10155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645942899"
     variation       10155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241485762"
     variation       10156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148730886"
     variation       10160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730888"
     variation       10162..10170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ataata"
                     /replace="ataataata"
                     /db_xref="dbSNP:1390527072"
     variation       10171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326405001"
     variation       10173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730897"
     variation       10178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571389709"
     variation       10179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571389716"
     variation       10181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730909"
     variation       10184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192178564"
     variation       10189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76010229"
     variation       10190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292086954"
     variation       10192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148730920"
     variation       10197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645943470"
     variation       10198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333357254"
     variation       10200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368787742"
     variation       10201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645943653"
     variation       10204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274276173"
     variation       10205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339109894"
     variation       10211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274900715"
     variation       10215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571547232"
     variation       10218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645943980"
     variation       10224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389776"
     variation       10226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438572134"
     variation       10231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557631973"
     variation       10233..10237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tc"
                     /replace="tcctc"
                     /db_xref="dbSNP:1645944220"
     variation       10233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468870902"
     variation       10234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927991002"
     variation       10235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944341"
     variation       10238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645944393"
     variation       10241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645944429"
     variation       10243..10247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:2148730948"
     variation       10246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197725041"
     variation       10248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730952"
     variation       10250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571389812"
     variation       10251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953944035"
     variation       10256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236172183"
     variation       10257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645944711"
     variation       10258..10261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:935320290"
     variation       10260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944817"
     variation       10261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944852"
     variation       10265
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944915"
     variation       10266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005197104"
     variation       10267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418357887"
     variation       10270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645945036"
     variation       10276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052981048"
     variation       10278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165885221"
     variation       10283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645945167"
     variation       10285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:893885209"
     variation       10289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538830586"
     variation       10292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554046305"
     variation       10295..10299
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatga"
                     /db_xref="dbSNP:1039846959"
     variation       10297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417210514"
     variation       10300..10306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gag"
                     /replace="gagtgag"
                     /db_xref="dbSNP:1166468590"
     variation       10300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645945523"
     variation       10309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397247151"
     variation       10311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016631003"
     variation       10316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79355955"
     variation       10321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374567306"
     variation       10323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998463302"
     variation       10324..10332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtttg"
                     /replace="gtttgtttg"
                     /db_xref="dbSNP:1645945883"
     variation       10326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1253380792"
     variation       10327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645945999"
     variation       10328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972340698"
     variation       10337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210421637"
     variation       10338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278367992"
     variation       10342..10346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aagta"
                     /db_xref="dbSNP:1645946188"
     variation       10343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486676421"
     variation       10350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730998"
     variation       10355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029907759"
     variation       10356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256800555"
     variation       10359..10362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tttt"
                     /db_xref="dbSNP:1427805956"
     variation       10364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190759460"
     variation       10366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331051161"
     variation       10370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886809352"
     variation       10371..10373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148731008"
     variation       10372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449770932"
     variation       10375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645946697"
     variation       10376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571389968"
     variation       10382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172599437"
     variation       10383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537611630"
     variation       10385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393337895"
     variation       10388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017098420"
     variation       10390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329859133"
     variation       10391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962457507"
     variation       10401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298262217"
     variation       10402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645947152"
     variation       10406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970880807"
     variation       10407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796216640"
     variation       10410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991745125"
     variation       10411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022772857"
     variation       10416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926698779"
     variation       10417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1211717696"
     variation       10420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765055734"
     variation       10424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645947544"
     variation       10425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231469789"
     variation       10429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645947772"
     variation       10432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938122072"
     variation       10434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645947863"
     variation       10435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645947901"
     variation       10436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536504767"
     variation       10441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645948019"
     variation       10442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645948072"
     variation       10445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263636608"
     variation       10449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750161490"
     variation       10451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645948761"
     variation       10455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645948795"
     variation       10456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192727380"
     variation       10458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645948898"
     variation       10460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557632206"
     variation       10463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645948999"
     variation       10469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645949043"
     variation       10470..10476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aagaaaa"
                     /db_xref="dbSNP:1392914826"
     variation       10470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645949105"
     variation       10477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645949205"
     variation       10478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:981350706"
     variation       10479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455253259"
     variation       10480..10488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tcat"
                     /replace="tcatttcat"
                     /db_xref="dbSNP:924520841"
     variation       10484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915277531"
     variation       10486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645949519"
     variation       10487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452338087"
     variation       10489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645949661"
     variation       10490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217983159"
     variation       10495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291110926"
     variation       10498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645949803"
     variation       10500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536507609"
     variation       10503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1389902328"
     variation       10504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440655487"
     variation       10507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645949979"
     variation       10508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555810167"
     variation       10513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042270233"
     variation       10521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950154"
     variation       10523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901095268"
     variation       10528..10533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttaatt"
                     /db_xref="dbSNP:1306471992"
     variation       10529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998002982"
     variation       10539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554734378"
     variation       10541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645950403"
     variation       10542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262448321"
     variation       10543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889519470"
     variation       10546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950528"
     variation       10548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:761407670"
     variation       10550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1005332944"
     variation       10551
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645950670"
     variation       10552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465261319"
     variation       10553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574671804"
     variation       10558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950821"
     variation       10562..10563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:765710979"
     variation       10562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554554773"
     variation       10571
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575943703"
     variation       10573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645951006"
     variation       10575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543584812"
     variation       10577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440347734"
     variation       10581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645951162"
     variation       10583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249253610"
     variation       10586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416767433"
     variation       10588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946799865"
     variation       10589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040176474"
     variation       10590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645951426"
     variation       10591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1571390306"
     variation       10594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766182338"
     variation       10597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645951578"
     variation       10600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645951627"
     variation       10606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994240347"
     variation       10610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026532078"
     variation       10611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564774699"
     variation       10612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645951847"
     variation       10618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934140536"
     variation       10619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532140374"
     variation       10620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645952015"
     variation       10621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397122822"
     variation       10624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752823385"
     variation       10627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645952175"
     variation       10633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475802643"
     variation       10636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769579976"
     variation       10638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051385703"
     variation       10642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1387279727"
     variation       10643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887318250"
     variation       10645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577137923"
     variation       10651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731147"
     variation       10653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645952594"
     variation       10655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571390376"
     variation       10656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645952695"
     variation       10658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645952755"
     variation       10662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571390379"
     variation       10670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329790878"
     variation       10671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232591929"
     variation       10673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645952994"
     variation       10674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016571419"
     variation       10675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541247710"
     variation       10678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221909151"
     variation       10681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953212"
     variation       10684..10687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1250436182"
     variation       10685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170656511"
     variation       10690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953349"
     variation       10693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012690951"
     variation       10696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731173"
     variation       10703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034292694"
     variation       10705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023122358"
     variation       10707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953543"
     variation       10708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1475198673"
     variation       10710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645953620"
     variation       10712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959441747"
     variation       10713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645953732"
     variation       10717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971236523"
     variation       10725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406344392"
     variation       10726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571390465"
     variation       10727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731193"
     variation       10731..10734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1170144354"
     variation       10731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756201441"
     variation       10732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571390483"
     variation       10733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645954035"
     variation       10736
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463669362"
     variation       10740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308776284"
     variation       10741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645954194"
     variation       10742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645954239"
     variation       10746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:797000"
     variation       10748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1413202362"
     variation       10749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314800058"
     variation       10752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1356235775"
     variation       10753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645954749"
     variation       10753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291336086"
     variation       10754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399312246"
     variation       10757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381191391"
     variation       10760
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645954902"
     variation       10762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293434777"
     variation       10766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645955000"
     variation       10782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955058"
     variation       10784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271937511"
     variation       10791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305415314"
     variation       10796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955199"
     variation       10797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149973488"
     variation       10798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645955307"
     variation       10800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274815717"
     variation       10806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978512280"
     variation       10810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485047376"
     variation       10814..10819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:988567911"
     variation       10816..10823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="catc"
                     /replace="catccatc"
                     /db_xref="dbSNP:1645955559"
     variation       10817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955621"
     variation       10818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645955670"
     variation       10821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260272129"
     variation       10827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148731236"
     variation       10828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473376114"
     variation       10831..10832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1645955865"
     variation       10833..10840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tta"
                     /replace="ttagatta"
                     /db_xref="dbSNP:915270251"
     variation       10835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1417796906"
     variation       10843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731249"
     variation       10845
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956028"
     variation       10846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956083"
     variation       10849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922523004"
     variation       10859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933923210"
     variation       10860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049564838"
     variation       10863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255212265"
     variation       10868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571390632"
     variation       10871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345239585"
     variation       10876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956465"
     variation       10877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374976353"
     variation       10879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645956563"
     variation       10881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645956616"
     variation       10885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956654"
     variation       10893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645956696"
     variation       10899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956744"
     variation       10902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432963371"
     variation       10908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557632608"
     variation       10910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956893"
     variation       10913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731274"
     variation       10915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645956933"
     variation       10916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956974"
     variation       10919
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749591113"
     variation       10920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957080"
     variation       10927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957267"
     variation       10928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314784229"
     variation       10938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541709462"
     variation       10941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645957439"
     variation       10942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645957482"
     variation       10943
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360833545"
     variation       10946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889656691"
     variation       10947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975558464"
     variation       10949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269434140"
     variation       10950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645957713"
     variation       10953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941085179"
     variation       10955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957762"
     variation       10956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370987082"
     variation       10960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645957861"
     variation       10966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557632654"
     variation       10967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561377490"
     variation       10968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645958029"
     variation       10970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645958078"
     variation       10975..10978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1212627138"
     variation       10977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645958200"
     variation       10979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230227545"
     variation       10986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557632676"
     variation       10987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038086877"
     variation       10988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958411"
     variation       10994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297912830"
     variation       10996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346659954"
     variation       10997
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231450945"
     variation       10999
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896914475"
     variation       11002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281771883"
     variation       11005..11010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1645958717"
     variation       11013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958777"
     variation       11018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257578153"
     variation       11020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215700811"
     variation       11025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531586139"
     variation       11026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958969"
     variation       11028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757525458"
     variation       11029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487708249"
     variation       11035
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487039969"
     variation       11043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571390780"
     variation       11045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72902981"
     variation       11048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260188111"
     variation       11050..11058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttttatatt"
                     /db_xref="dbSNP:934150347"
     variation       11050..11053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645959570"
     variation       11055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645959687"
     variation       11059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645959736"
     variation       11060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175609979"
     variation       11061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425938053"
     variation       11067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645959918"
     variation       11070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051230848"
     variation       11071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645960017"
     variation       11079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317511757"
     variation       11085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906771930"
     variation       11087
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040157330"
     variation       11090
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731364"
     variation       11091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437053986"
     variation       11095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940262733"
     variation       11098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645960401"
     variation       11099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171516285"
     variation       11104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231609646"
     variation       11108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645960576"
     variation       11110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183246331"
     variation       11112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148731378"
     variation       11113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033807276"
     variation       11115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645960749"
     variation       11120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645960818"
     variation       11122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645960867"
     variation       11124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645960923"
     variation       11125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223766443"
     variation       11126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959493286"
     variation       11128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282794742"
     variation       11131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331785007"
     variation       11135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565061414"
     variation       11136..11139
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggtg"
                     /replace="ggtggtg"
                     /db_xref="dbSNP:1433070917"
     variation       11141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961260"
     variation       11145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961306"
     variation       11151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731402"
     variation       11152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252699110"
     variation       11158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:989617154"
     variation       11160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324155466"
     variation       11161..11163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:35360401"
     variation       11164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022309525"
     variation       11165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247403885"
     variation       11166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645961677"
     variation       11167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645961719"
     variation       11168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469669349"
     variation       11169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645961803"
     variation       11171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:966786785"
     variation       11173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645961931"
     variation       11175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961981"
     variation       11177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978102549"
     variation       11178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458699622"
     variation       11180..11192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcagttgctctc"
                     /replace="ctcagttgctctcagttgctctc"
                     /db_xref="dbSNP:932315942"
     variation       11182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772665781"
     variation       11183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645962253"
     variation       11186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438311565"
     variation       11190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645962360"
     variation       11193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331275123"
     variation       11195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645962442"
     variation       11196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731442"
     variation       11200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440877349"
     variation       11203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645962519"
     variation       11207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645962556"
     variation       11208..11212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1645962608"
     variation       11210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645962698"
     variation       11210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933913300"
     variation       11215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1277194365"
     variation       11216..11217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1645962827"
     variation       11216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1352880263"
     variation       11219
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229529982"
     variation       11220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645962916"
     variation       11222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:985818181"
     variation       11225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780359581"
     variation       11228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645963039"
     variation       11231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532437523"
     variation       11232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333104450"
     variation       11233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941138142"
     variation       11235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963237"
     variation       11238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547982368"
     variation       11241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963342"
     variation       11244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645963392"
     variation       11246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290902326"
     variation       11247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373686806"
     variation       11250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179771257"
     variation       11252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963572"
     variation       11254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963634"
     variation       11255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1254058861"
     variation       11256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473570625"
     variation       11257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645963769"
     variation       11258..11264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aata"
                     /replace="aataata"
                     /db_xref="dbSNP:1645963806"
     variation       11259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929744265"
     variation       11262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1368577431"
     variation       11266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645963949"
     variation       11267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964002"
     variation       11269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342960689"
     variation       11270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236022849"
     variation       11272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391071"
     variation       11274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645964181"
     variation       11275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955855642"
     variation       11276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964273"
     variation       11280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280679964"
     variation       11281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391096"
     variation       11283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011523316"
     variation       11285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964460"
     variation       11288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964497"
     variation       11292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566097843"
     variation       11296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351790848"
     variation       11298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645964638"
     variation       11300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964690"
     variation       11302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964746"
     variation       11306..11316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgacttactg"
                     /db_xref="dbSNP:1557632990"
     variation       11311..11313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tta"
                     /db_xref="dbSNP:1411012960"
     variation       11313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964884"
     variation       11316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964938"
     variation       11318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557632999"
     variation       11323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968116522"
     variation       11325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262009984"
     variation       11326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537000935"
     variation       11335..11337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1487119334"
     variation       11335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645965170"
     variation       11339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548591833"
     variation       11340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569703352"
     variation       11341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965386"
     variation       11344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955413619"
     variation       11348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965488"
     variation       11351
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965534"
     variation       11352
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645965587"
     variation       11353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001213093"
     variation       11354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276915536"
     variation       11355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:751069758"
     variation       11356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537024441"
     variation       11357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055271617"
     variation       11358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210193915"
     variation       11359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645965962"
     variation       11362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256753454"
     variation       11366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895417653"
     variation       11368..11380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgcactgagtatt"
                     /replace="tgcactgagtattgcactgagtatt"
                     /db_xref="dbSNP:1195903376"
     variation       11368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011008122"
     variation       11372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986984923"
     variation       11373..11377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgagt"
                     /db_xref="dbSNP:1645966287"
     variation       11376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645966332"
     variation       11377..11381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tattt"
                     /db_xref="dbSNP:1645966383"
     variation       11381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368812370"
     variation       11391..11392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:768505111"
     variation       11393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908733349"
     variation       11403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022445034"
     variation       11406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940169695"
     variation       11407..11408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1429852086"
     variation       11407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645966696"
     variation       11412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645966780"
     variation       11413..11418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="atcttt"
                     /db_xref="dbSNP:1645966820"
     variation       11415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645966871"
     variation       11416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645966935"
     variation       11423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038648489"
     variation       11426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645967015"
     variation       11429..11435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="act"
                     /replace="acttact"
                     /db_xref="dbSNP:1439339547"
     variation       11430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920167348"
     variation       11431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558557808"
     variation       11435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454227670"
     variation       11436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645967251"
     variation       11437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1335354894"
     variation       11441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645967331"
     variation       11442..11445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:760214668"
     variation       11442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577028704"
     variation       11443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645967498"
     variation       11444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645967559"
     variation       11448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292926775"
     variation       11450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1233660586"
     variation       11452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645967686"
     variation       11454..11456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645967724"
     variation       11455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747536325"
     variation       11459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:534379333"
     variation       11472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000050388"
     variation       11475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645967961"
     variation       11477..11484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttgtt"
                     /replace="ttgttgtt"
                     /db_xref="dbSNP:774358868"
     variation       11492
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645968060"
     variation       11494..11497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:1482267019"
     variation       11495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906981995"
     variation       11498..11504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctc"
                     /replace="ctcactc"
                     /db_xref="dbSNP:1645968230"
     variation       11499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002603071"
     variation       11502..11505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1392008923"
     variation       11510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442744285"
     variation       11513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029659910"
     variation       11517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571391359"
     variation       11518..11519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1449640571"
     variation       11523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645968581"
     variation       11524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172540728"
     variation       11528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645968854"
     variation       11530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375424872"
     variation       11531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645968957"
     variation       11532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891663260"
     variation       11535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645969054"
     variation       11536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955516294"
     variation       11537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13374690"
     variation       11538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186500181"
     variation       11539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761501941"
     variation       11543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021545390"
     variation       11546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366214165"
     variation       11549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645969491"
     variation       11552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900384495"
     variation       11554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301418755"
     variation       11555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391431"
     variation       11557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645969750"
     variation       11558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645969790"
     variation       11562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313994790"
     variation       11563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962637582"
     variation       11565
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645969978"
     variation       11567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645970022"
     variation       11569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973883790"
     variation       11573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148731634"
     variation       11574
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256538396"
     variation       11575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349816459"
     variation       11579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308492815"
     variation       11584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249913556"
     variation       11586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996864302"
     variation       11587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645970400"
     variation       11589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645970455"
     variation       11590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249649614"
     variation       11595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645970856"
     variation       11600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542145695"
     variation       11601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645970961"
     variation       11612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971016"
     variation       11613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971074"
     variation       11614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563417423"
     variation       11615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773087620"
     variation       11619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971253"
     variation       11625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576054752"
     variation       11629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645971355"
     variation       11630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645971407"
     variation       11633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543429815"
     variation       11634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215887950"
     variation       11637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176111045"
     variation       11638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571391522"
     variation       11639..11648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaaaaa"
                     /replace="aaaaaaaaaa"
                     /replace="aaaaaaaaaaa"
                     /db_xref="dbSNP:148090796"
     variation       11639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:928413251"
     variation       11648..11649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1571391534"
     variation       11648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191452426"
     variation       11649..11656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1015679361"
     variation       11649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182527149"
     variation       11650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645972168"
     variation       11651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369938681"
     variation       11654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974606597"
     variation       11655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1387455843"
     variation       11658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645972514"
     variation       11660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645972635"
     variation       11661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645972708"
     variation       11666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145217568"
     variation       11667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565342652"
     variation       11668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645973107"
     variation       11672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980305904"
     variation       11673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043862956"
     variation       11677
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902717828"
     variation       11678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329582447"
     variation       11686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645973519"
     variation       11688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999700616"
     variation       11689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928334836"
     variation       11690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419816438"
     variation       11694..11699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1645974053"
     variation       11695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164176522"
     variation       11706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415503827"
     variation       11707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645974332"
     variation       11710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471932731"
     variation       11712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938344896"
     variation       11718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376645263"
     variation       11719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188384146"
     variation       11720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548893620"
     variation       11724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006870978"
     variation       11725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299599273"
     variation       11728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731724"
     variation       11729
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297748652"
     variation       11731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975152"
     variation       11734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368752337"
     variation       11735
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:947249893"
     variation       11742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975310"
     variation       11743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975356"
     variation       11748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192876785"
     variation       11752..11756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cataa"
                     /replace="cataattccataattccataa"
                     /db_xref="dbSNP:1645975465"
     variation       11755..11768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagccac"
                     /replace="aagccacaagccac"
                     /db_xref="dbSNP:369200119"
     variation       11755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232464621"
     variation       11759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975673"
     variation       11761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996060361"
     variation       11762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975778"
     variation       11763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975833"
     variation       11764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962606885"
     variation       11768..11790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgggcccagcctcttttacctg"
                     /db_xref="dbSNP:1645975920"
     variation       11769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975972"
     variation       11771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323198939"
     variation       11772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571391707"
     variation       11776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1221838658"
     variation       11776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030240996"
     variation       11777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645976236"
     variation       11778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891165367"
     variation       11779..11782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:2148731754"
     variation       11781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570383674"
     variation       11783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645976445"
     variation       11784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475127738"
     variation       11785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015678868"
     variation       11787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391747"
     variation       11794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731770"
     variation       11798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571391757"
     variation       11799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437672957"
     variation       11809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557633486"
     variation       11810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424657866"
     variation       11821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169982834"
     variation       11825
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918514248"
     variation       11827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431744049"
     variation       11829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1308645978"
     variation       11829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951256614"
     variation       11830..11831
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:1645977129"
     variation       11830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981312528"
     variation       11832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645977184"
     variation       11834..11837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1645977241"
     variation       11837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300930716"
     variation       11839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645977370"
     variation       11842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645977428"
     variation       11846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381025451"
     variation       11849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:928351968"
     variation       11860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645977573"
     variation       11861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228577338"
     variation       11861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645977661"
     variation       11862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753949706"
     variation       11864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937117617"
     variation       11865..11868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645977831"
     variation       11867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645977865"
     variation       11871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339586279"
     variation       11874..11876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1645977959"
     variation       11883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645978012"
     variation       11884..11885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1645978071"
     variation       11893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229978878"
     variation       11894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481089017"
     variation       11896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391859"
     variation       11897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485670167"
     variation       11904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645978364"
     variation       11905..11908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1208604089"
     variation       11909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391875"
     variation       11915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645978528"
     variation       11917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239632219"
     variation       11920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978639"
     variation       11922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645978711"
     variation       11928..11931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645978750"
     variation       11930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391892"
     variation       11934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978883"
     variation       11935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978962"
     variation       11937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979016"
     variation       11940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645979058"
     variation       11943
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645979099"
     variation       11945
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055378139"
     variation       11949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187262885"
     variation       11950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914270513"
     variation       11951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946964831"
     variation       11959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979475"
     variation       11960..11965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1476134044"
     variation       11960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645979511"
     variation       11969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979626"
     variation       11971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043914988"
     variation       11972..11973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1645979734"
     variation       11977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645979785"
     variation       11979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391932"
     variation       11980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645979859"
     variation       11981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391941"
     variation       11984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979951"
     variation       11986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645980009"
     variation       11988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645980093"
     variation       11991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902770990"
     variation       11992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027592148"
     variation       11994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645980281"
     variation       12000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185134170"
     variation       12012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645980422"
     variation       12014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173836103"
     variation       12018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360773338"
     variation       12022
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552211427"
     variation       12024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570414684"
     variation       12026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645980706"
     variation       12028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190068140"
     variation       12035
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172290343"
     variation       12036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757576530"
     variation       12037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645981388"
     variation       12041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938353158"
     variation       12047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007008303"
     variation       12052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018285710"
     variation       12053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149163525"
     variation       12054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645981704"
     variation       12056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912995495"
     variation       12057
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310507008"
     variation       12061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356863618"
     variation       12065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645981907"
     variation       12070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313235178"
     variation       12075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645982028"
     variation       12089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898460552"
     variation       12095..12104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttctt"
                     /replace="tttctttctt"
                     /db_xref="dbSNP:1246563466"
     variation       12098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:193204277"
     variation       12106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042793716"
     variation       12108..12134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agaacaaccagtgtcaccaggtatgag"
                     /replace="agaacaaccagtgtcaccaggtatgagaacaaccagtgtcaccaggta
                     tgag"
                     /db_xref="dbSNP:1339311810"
     variation       12112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477092800"
     variation       12114..12127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="accag"
                     /replace="accagtgtcaccag"
                     /db_xref="dbSNP:1213116304"
     variation       12116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427185544"
     variation       12118
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771887940"
     variation       12123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1308271391"
     variation       12124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571392090"
     variation       12127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210499147"
     variation       12128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900361502"
     variation       12130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731916"
     variation       12132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645982854"
     variation       12135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645982902"
     variation       12138..12141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1645982951"
     variation       12139
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645983009"
     variation       12141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386145677"
     variation       12147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255478039"
     variation       12154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645983185"
     variation       12156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320837542"
     variation       12162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1330109319"
     variation       12174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433685241"
     variation       12176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486733663"
     variation       12177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368992746"
     variation       12178..12188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atttatt"
                     /replace="atttatttatt"
                     /db_xref="dbSNP:1557633790"
     variation       12182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645983564"
     variation       12189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228316139"
     variation       12190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267078324"
     variation       12191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867210431"
     variation       12192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535270883"
     variation       12198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731956"
     variation       12200..12201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:2148731957"
     variation       12202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:556704991"
     variation       12205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266666866"
     variation       12206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995516199"
     variation       12207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143723018"
     variation       12216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027816144"
     variation       12217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645984324"
     variation       12218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184939951"
     variation       12224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564988943"
     variation       12230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645984513"
     variation       12231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037409376"
     variation       12232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897137584"
     variation       12234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645984671"
     variation       12235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478352732"
     variation       12238..12239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1645984799"
     variation       12240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433687798"
     variation       12241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645984944"
     variation       12245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958443914"
     variation       12246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645985054"
     variation       12247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991235686"
     variation       12248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1409603894"
     variation       12248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473468758"
     variation       12256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159541645"
     variation       12257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996026993"
     variation       12261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548438182"
     variation       12263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645985441"
     variation       12268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947018571"
     variation       12269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434722116"
     variation       12270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571392261"
     variation       12275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645985663"
     variation       12276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349919648"
     variation       12278..12285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taa"
                     /replace="taagataa"
                     /db_xref="dbSNP:755974130"
     variation       12281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977126034"
     variation       12284..12293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aat"
                     /replace="aatacccaat"
                     /db_xref="dbSNP:1645985908"
     variation       12284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645985847"
     variation       12288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645985973"
     variation       12292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001619664"
     variation       12296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550918434"
     variation       12297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645986209"
     variation       12299
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986255"
     variation       12306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1229399720"
     variation       12309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283911043"
     variation       12313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11263839"
     variation       12317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051688201"
     variation       12320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891328088"
     variation       12323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986782"
     variation       12326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780701723"
     variation       12327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986930"
     variation       12329..12331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1645987003"
     variation       12330
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146481099"
     variation       12341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249536680"
     variation       12342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278385240"
     variation       12343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645987953"
     variation       12345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350343925"
     variation       12348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645988075"
     variation       12349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968398401"
     variation       12355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559571643"
     variation       12359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645988275"
     variation       12361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995485036"
     variation       12365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414006163"
     variation       12366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645988661"
     variation       12373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645988724"
     variation       12374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445175870"
     variation       12376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305566237"
     variation       12382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1372959969"
     variation       12383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217920228"
     variation       12384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333997978"
     variation       12386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645989073"
     variation       12392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025669719"
     variation       12397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645989207"
     variation       12401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645989264"
     variation       12414..12418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1645989313"
     variation       12416..12418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1242470958"
     variation       12416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247378787"
     variation       12422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453640010"
     variation       12423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989501"
     variation       12427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571392461"
     variation       12428..12433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1645989615"
     variation       12429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989673"
     variation       12435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921698461"
     variation       12443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191519402"
     variation       12446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887014334"
     variation       12447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645989900"
     variation       12448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989950"
     variation       12450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533887056"
     variation       12451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530183670"
     variation       12455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276852075"
     variation       12460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344318585"
     variation       12464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990366"
     variation       12469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002828799"
     variation       12470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645990508"
     variation       12471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035927223"
     variation       12473..12475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1396447344"
     variation       12473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958491341"
     variation       12477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440503374"
     variation       12478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454463169"
     variation       12479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990826"
     variation       12482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990904"
     variation       12485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157441159"
     variation       12490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991020"
     variation       12495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243379749"
     variation       12498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645991123"
     variation       12510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051559876"
     variation       12514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166236015"
     variation       12515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391478845"
     variation       12517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991327"
     variation       12526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769437079"
     variation       12531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1382205794"
     variation       12534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021299293"
     variation       12538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320931704"
     variation       12542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400641517"
     variation       12543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645991632"
     variation       12546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390026558"
     variation       12548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940563221"
     variation       12550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772679199"
     variation       12552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991938"
     variation       12563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645991998"
     variation       12564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645992071"
     variation       12568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301734060"
     variation       12570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542071503"
     variation       12572
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140969609"
     variation       12578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645992325"
     variation       12583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645992383"
     variation       12586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645992429"
     variation       12587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645992477"
     variation       12588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:924330559"
     variation       12589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255367362"
     variation       12591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342701448"
     variation       12592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935573817"
     variation       12594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148732198"
     variation       12596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279007528"
     variation       12600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987031222"
     variation       12601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263511842"
     variation       12607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645992926"
     variation       12610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61588338"
     variation       12613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645993120"
     variation       12615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993181"
     variation       12616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762650705"
     variation       12617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151209493"
     variation       12619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3185860"
     variation       12620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645993405"
     variation       12621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:617254"
     variation       12625..12632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctattct"
                     /replace="tctattctattct"
                     /db_xref="dbSNP:1645993556"
     variation       12628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546851825"
     variation       12632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047496021"
     variation       12634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993755"
     variation       12641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:887152481"
     variation       12644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993882"
     variation       12646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528057622"
     variation       12649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254691093"
     variation       12654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994114"
     variation       12658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994175"
     variation       12662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322836145"
     variation       12670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468625617"
     variation       12671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546700653"
     variation       12673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994690"
     variation       12675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994738"
     variation       12682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035797650"
     variation       12683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148732262"
     variation       12686..12689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1329329536"
     variation       12689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057016314"
     variation       12690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774166730"
     variation       12694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894411906"
     variation       12699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328197100"
     variation       12703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:617673"
     variation       12711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645995262"
     variation       12713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767517357"
     variation       12716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645995367"
     variation       12720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645995429"
     variation       12722..12723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1571392793"
     variation       12722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269631761"
     variation       12724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021438273"
     variation       12726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470842580"
     variation       12731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:968427356"
     variation       12732..12733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645995834"
     variation       12732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1158659180"
     variation       12733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538220647"
     variation       12734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645995946"
     variation       12742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148732301"
     variation       12748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998649331"
     variation       12749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208787348"
     variation       12750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645996125"
     variation       12755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732312"
     variation       12767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1264651380"
     variation       12767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645996176"
     variation       12768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645996290"
     variation       12771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645996337"
     variation       12772..12776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ga"
                     /replace="gagga"
                     /db_xref="dbSNP:2148732324"
     variation       12772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435467966"
     variation       12774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031750925"
     variation       12779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461411805"
     variation       12788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645996576"
     variation       12791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411815515"
     variation       12795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471831102"
     variation       12796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161741391"
     variation       12797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010933207"
     variation       12799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954369519"
     variation       12800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535494736"
     variation       12802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645996920"
     variation       12803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397201950"
     variation       12811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997025"
     variation       12816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291927465"
     variation       12817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997119"
     variation       12819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556743507"
     variation       12822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:912794404"
     variation       12827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:568710793"
     variation       12828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328509541"
     variation       12838..12839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645997459"
     variation       12839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349724926"
     variation       12840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645997560"
     variation       12841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997604"
     variation       12846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997657"
     variation       12847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964311587"
     variation       12850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645997748"
     variation       12855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975565048"
     variation       12860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645997839"
     variation       12861..12865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1289970722"
     variation       12861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920123616"
     variation       12862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931383205"
     variation       12863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645998053"
     variation       12865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317214475"
     variation       12866
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645998148"
     variation       12867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921685638"
     variation       12870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263224418"
     variation       12871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645998386"
     variation       12873
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645998430"
     variation       12877..12887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagaagaa"
                     /replace="aagaagaagaa"
                     /db_xref="dbSNP:1489191079"
     variation       12880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047104846"
     variation       12887..12893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aag"
                     /replace="aagtaag"
                     /db_xref="dbSNP:953077202"
     variation       12887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482325926"
     variation       12890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:987319587"
     variation       12891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645998748"
     variation       12906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908631026"
     variation       12915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423500069"
     variation       12920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645998885"
     variation       12924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645998944"
     variation       12926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334020336"
     variation       12927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732424"
     variation       12932..12937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttgttt"
                     /db_xref="dbSNP:1425388438"
     variation       12932..12936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:551871231"
     variation       12935..12937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1571393013"
     variation       12936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645999245"
     variation       12939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307434820"
     variation       12943
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754003469"
     variation       12946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911758811"
     variation       12947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763435450"
     variation       12951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373764064"
     variation       12956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:894380672"
     variation       12958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11803162"
     variation       12959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323075098"
     variation       12963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393070"
     variation       12965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645999839"
     variation       12969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195017326"
     variation       12977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557614640"
     variation       12981
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340744989"
     variation       12983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207879034"
     variation       12984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233865788"
     variation       12987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646000122"
     variation       12989
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646000167"
     variation       12992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646000219"
     variation       12995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483140763"
     variation       12996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188246113"
     variation       13000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180440137"
     variation       13005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646000397"
     variation       13006
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1258548504"
     variation       13009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646000491"
     variation       13019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646000550"
     variation       13026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445453595"
     variation       13029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388370039"
     variation       13037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427799237"
     variation       13039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646001427"
     variation       13040..13041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1646001486"
     variation       13042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172476848"
     variation       13049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646001597"
     variation       13050..13054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1465366528"
     variation       13050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300800227"
     variation       13051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646001729"
     variation       13053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384613036"
     variation       13057
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765512570"
     variation       13061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296280568"
     variation       13062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646001941"
     variation       13073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:999103079"
     variation       13076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031390116"
     variation       13078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1274361357"
     variation       13081
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312064304"
     variation       13089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048361259"
     variation       13095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954633333"
     variation       13106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008543100"
     variation       13111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1646002395"
     variation       13111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646002331"
     variation       13114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258131628"
     variation       13120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148732519"
     variation       13123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646002496"
     variation       13124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646002562"
     variation       13125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646002643"
     variation       13126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461969099"
     variation       13130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646002723"
     variation       13140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646002777"
     variation       13141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750676879"
     variation       13145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372215826"
     variation       13150..13155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agatag"
                     /replace="agatagatag"
                     /db_xref="dbSNP:747128678"
     variation       13150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246372871"
     variation       13151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646003040"
     variation       13153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541089374"
     variation       13155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420464265"
     variation       13161..13163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1458669625"
     variation       13165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420152307"
     variation       13167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975699442"
     variation       13170..13173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1646003844"
     variation       13174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920175823"
     variation       13177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1407985565"
     variation       13181..13186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:879476871"
     variation       13182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553296373"
     variation       13184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983370268"
     variation       13188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166121037"
     variation       13192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000280959"
     variation       13194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646004353"
     variation       13196..13197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1028638611"
     variation       13197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571393323"
     variation       13198..13205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:537923747"
     variation       13198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:908602603"
     variation       13199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181064431"
     variation       13202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542295369"
     variation       13205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:563919064"
     variation       13206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112898338"
     variation       13207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480657929"
     variation       13208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646005279"
     variation       13209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249438005"
     variation       13222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341003490"
     variation       13224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646005638"
     variation       13227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948637090"
     variation       13228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409385468"
     variation       13233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042915926"
     variation       13234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318454112"
     variation       13238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348773393"
     variation       13242..13249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atga"
                     /replace="atgaatga"
                     /replace="atgaatgaatga"
                     /db_xref="dbSNP:927327408"
     variation       13246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346625871"
     variation       13250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937333611"
     variation       13253
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546552052"
     variation       13259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646006216"
     variation       13262..13270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aata"
                     /replace="aataaaata"
                     /db_xref="dbSNP:1646006249"
     variation       13265..13268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1057183876"
     variation       13265
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646006294"
     variation       13266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1353187187"
     variation       13269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895865063"
     variation       13271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278971952"
     variation       13279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113322531"
     variation       13285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751968895"
     variation       13290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1041857755"
     variation       13291..13293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1490476437"
     variation       13292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260154197"
     variation       13293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646006975"
     variation       13294..13301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tatt"
                     /replace="tatttatt"
                     /db_xref="dbSNP:1181268134"
     variation       13294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409449668"
     variation       13296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556209808"
     variation       13297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646007200"
     variation       13300..13301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1158810267"
     variation       13303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412573968"
     variation       13305
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646007375"
     variation       13311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890196881"
     variation       13315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164876514"
     variation       13318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366804179"
     variation       13323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000473891"
     variation       13324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646007686"
     variation       13325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646007746"
     variation       13327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:528752687"
     variation       13332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371743303"
     variation       13333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732668"
     variation       13337..13342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1646007997"
     variation       13337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337878891"
     variation       13338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008067"
     variation       13342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017276949"
     variation       13345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646008138"
     variation       13349..13355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agta"
                     /replace="agtagta"
                     /db_xref="dbSNP:1571393515"
     variation       13350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1646008232"
     variation       13352
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008319"
     variation       13354..13364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taaataa"
                     /replace="taaataaataa"
                     /db_xref="dbSNP:1463701048"
     variation       13357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283853555"
     variation       13365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354426697"
     variation       13367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008521"
     variation       13368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008564"
     variation       13372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008605"
     variation       13378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008643"
     variation       13379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029234276"
     variation       13380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008780"
     variation       13390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360124812"
     variation       13392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204324335"
     variation       13397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755507279"
     variation       13400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994515114"
     variation       13400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1248268375"
     variation       13406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1646009159"
     variation       13409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646009214"
     variation       13411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439377406"
     variation       13416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646009303"
     variation       13422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027212716"
     variation       13423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150294351"
     variation       13424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646009423"
     variation       13426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732720"
     variation       13428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375077345"
     variation       13432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646009514"
     variation       13440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471600869"
     variation       13444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393572"
     variation       13445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184975862"
     variation       13446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137937874"
     variation       13448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646009749"
     variation       13450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018716062"
     variation       13454
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747667827"
     variation       13455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557634949"
     variation       13456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972327090"
     variation       13457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755634987"
     variation       13458..13460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1333857852"
     variation       13460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992913212"
     variation       13461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027513323"
     variation       13463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866611493"
     variation       13464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915999164"
     variation       13465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571393625"
     variation       13466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315881943"
     variation       13467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948694188"
     variation       13468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951959518"
     variation       13469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646010429"
     variation       13470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369177016"
     variation       13471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1249546128"
     variation       13472..13479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:926539078"
     variation       13476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646010659"
     variation       13480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646010719"
     variation       13481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978750367"
     variation       13482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1277644378"
     variation       13484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646010976"
     variation       13485..13493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggggtaggg"
                     /db_xref="dbSNP:1459736713"
     variation       13485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757440604"
     variation       13486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646011106"
     variation       13487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646011168"
     variation       13490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937345012"
     variation       13495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011287"
     variation       13498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011345"
     variation       13499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732793"
     variation       13500..13518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggagggtggagaagagag"
                     /replace="gggagggtggagaagagagggagggtggagaagagag"
                     /db_xref="dbSNP:1646011402"
     variation       13504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646011442"
     variation       13506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992754289"
     variation       13507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1557635040"
     variation       13511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777335358"
     variation       13512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011644"
     variation       13513..13522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agagagag"
                     /replace="agagagagag"
                     /replace="agagagagagag"
                     /db_xref="dbSNP:917332610"
     variation       13513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400487753"
     variation       13514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052949107"
     variation       13516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337672685"
     variation       13517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042173951"
     variation       13519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433002965"
     variation       13520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890323189"
     variation       13523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944523722"
     variation       13526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646012268"
     variation       13527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926170271"
     variation       13530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646012396"
     variation       13532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328194233"
     variation       13536
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228031040"
     variation       13537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274083950"
     variation       13538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038766385"
     variation       13539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936153832"
     variation       13542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646012670"
     variation       13543..13546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1646012732"
     variation       13547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646012802"
     variation       13548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646012848"
     variation       13552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646012914"
     variation       13553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900268718"
     variation       13555..13559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gctcc"
                     /db_xref="dbSNP:1646013091"
     variation       13555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263381056"
     variation       13559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646013169"
     variation       13561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:994483877"
     variation       13562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027759385"
     variation       13564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260081808"
     variation       13567..13572
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1430597782"
     variation       13573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189626933"
     variation       13576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748935515"
     variation       13577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646013928"
     variation       13581..13582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1646013985"
     variation       13582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646014059"
     variation       13584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646014128"
     variation       13585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571393759"
     variation       13586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888693143"
     variation       13587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393772"
     variation       13588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529029363"
     variation       13591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550254208"
     variation       13593
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448127823"
     variation       13597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198804497"
     variation       13603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452846937"
     variation       13606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646014790"
     variation       13607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568745685"
     variation       13608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539225869"
     variation       13609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481624921"
     variation       13610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646014975"
     variation       13611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646015038"
     variation       13615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646015106"
     variation       13617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177526516"
     variation       13622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557502575"
     variation       13623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008583388"
     variation       13626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770599707"
     variation       13627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566671117"
     variation       13630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571393823"
     variation       13633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290747057"
     variation       13634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385739329"
     variation       13636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992965566"
     variation       13637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149480174"
     variation       13640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359870567"
     variation       13642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571393854"
     variation       13643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452955599"
     variation       13644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372205273"
     variation       13645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646016011"
     variation       13646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283671820"
     variation       13656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387050257"
     variation       13657..13659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1328134606"
     variation       13658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236404859"
     variation       13660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435466336"
     variation       13662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978718021"
     variation       13663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993290863"
     variation       13665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016404"
     variation       13666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925979776"
     variation       13667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951950535"
     variation       13670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732980"
     variation       13673..13675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1646016530"
     variation       13676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732983"
     variation       13680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955978316"
     variation       13682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016728"
     variation       13683..13687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtg"
                     /replace="gtgtg"
                     /db_xref="dbSNP:1490979203"
     variation       13684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200680347"
     variation       13687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016843"
     variation       13689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251501560"
     variation       13690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989092655"
     variation       13693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145835702"
     variation       13694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138746703"
     variation       13698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960582832"
     variation       13701..13703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:530985639"
     variation       13704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646017641"
     variation       13707..13710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:150609292"
     variation       13712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148733025"
     variation       13714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1557635273"
     variation       13714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967767747"
     variation       13715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646017835"
     variation       13717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303579430"
     polyA_site      13721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
actggcagctggccgggcgctcgcagtgggagctgctgcaggctccgcggcggcggcaacggaggctgcgggggcggcggcgcgagcggccgggcttggtaggggagccgagcccggcccgggatcccgagcagcgagagtgtggggtacctaggcccctcacgctggacttcacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcgggcgcttacctgccccccctgcagcaggtgttccaggcacctcgccggcctggcattggcactgtggggaaaccaatcaagctcctggccaattactttgaggtggacatccctaagatcgacgtgtaccactacgaggtggacatcaagccggataagtgtccccgtagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcctgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaacgaacgggtcgactttgaggtgacaatccctggggaagggaaggatcgaatctttaaggtctccatcaagtggctagccattgtgagctggcgaatgctgcatgaggccctggtcagcggccagatccctgttcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttttataaggcacagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgcgttcgcttcaccaaggagatcaagggcctgaaggtggaagtcacccactgtggacagatgaagaggaagtaccgcgtgtgtaatgttacccgtcgccctgctagccatcagacattccccttacagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccatctgccctgcctacaagttggccaggaacaaaagcatacctaccttcccctagaggtctgtaacattgtggctgggcagcgctgtattaaaaagctgaccgacaaccagacctcgaccatgataaaggccacagctagatccgctccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttgggatcaaagtgaaggatgacatgacggaggtgacagggcgagtgctgccggcgcccatcttgcagtacggcggccgggtgagcaggaaccgggccattgccacacccaatcagggtgtctgggacatgcgggggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacagtgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcctatccagggtcaaccttgtttctgcaaatatgcacagggggcagacagcgtggagcctatgttccggcatctcaagaacacctactcagggctgcagctcattattgtcatcctgccagggaagacgccggtgtatgctgaggtgaaacgtgtcggagatacactcttgggaatggctacgcagtgtgtgcaggtgaagaacgtggtcaagacctcacctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgccgtttttcaacagccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgtgctactgtgcgggtacagcgaccacggcaagagatcattgaagacttgtcctacatggtgcgtgagctcctcatccaattctacaagtccacccgtttcaagcctacccgcatcatcttctaccgagatggggtgcctgaaggccagctaccccagatactccactatgagctactggccattcgtgatgcctgcatcaaactggaaaaggactaccagcctgggatcacttatattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaatgagcgaattgggaagagtggtaacatcccagctgggaccacagtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccagggcaccagccgaccatcccattactatgttctttgggatgacaaccgtttcacagcagatgagctccagatcctgacgtaccagctgtgccacacttacgtacgatgcacacgctctgtctctatcccagcacctgcctactatgcccgcctggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagaggggagccacatatcggggcagagcaatgggcgggacccccaggccctggccaaagccgtgcaggttcaccaggatactctgcgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccccaggagctgtgccacccaaatccagaggaagcaaggaggagggaggtggggtagggaggagtgtaggatgccttgtttccttctatagaggtggtgtaagagtggggaacagggccagcaagacagaccaccagccagaaatctctgatatcaacctcatgtcccccacccctcaccccatcttgtcacatctggccctgaccccactggaccaaaaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtaaggtcaactctgtagccctgcagacaaaagctggttaggtttgggtttgatactttagatgggaaagtgaggggcttgagaaagtgggtgggaggagggaaggattttttaggagccttaatcagaaaaggactagatttgtttaagaagaaaaatgaaaccagacccagatcaatattttaggatactagatgttttaatgggttcagaatccagtttgtaggaagattttttaatggttttggttgctcctcccccagctgccaccccccaccttacccttattcctctctgtccacattttctgccccaccttacttctcctccctgacagacatccagcccctagtaatacttaaggcactatggcacttagctttgaagtgacacgaccctgtcttccttccgcccgctggtgggtaaccagtgccttccctgtaacggtaatgctgcagaactgcaaccttttgtacctttctttggggaatggggtgggggtgggagaggaggtagatggggaagaaataccccagacccaacaaacctccagccagaaagccagctattttgcatttgaaggaattgacttcctcattcattgagctttttaaaagatcacaacctcaagatggttaaaatccattgacatttgcactttcaaacatgacaagtctcggagctgctgagatgacaggcccctggcctttccacttatgcctccttttctccttattcctcctacctcccgccccgcccaggtctggagttactttcatagcatttttcactcttggcttcttttctcccttgatggtcaagtctcttatgtttcaatatttcttaactggggtgtcttataacaaaaaactcttaggtctaaaatgagaaaaaagagagaaaacaaaatgttatttttataccataacttgagtgtattgccaaaatttggaaatccttcccatgcctgatgagtttatatcccagaaacattgagccatcagaatgaactgtgtacctgatttgttctctgacctggctaggtagggagggggtggttatcgccccaagatggggtccaggctccatccttcctctgtgcagataatacctttttcttgctatagcctccctcctctgcactgtcctgcactctttcttgcaagtgcatctttttccttcccctggactgtcctctgaccctttggctcatcctagattgcagtgtgtcctgtggacaggctggggaattttgctgctccctattgcttctgtttacaaaaatgaatttttcctggtttcccactagggcatgtgggtgggtggcatggacttttttttttttttttttttgtcttgagacatggggtttggctgtcttgcaggactggagaaggtggtggttctagcttggtctctgttggccttgaagcaagcatcccccctgccctttttccttgactgttcatttttttcctgccccactgcttgggatggggagttgcaacttcagtgtggaatttcctctttgaggagcctgggcttggatctatcctgatctggtgatgaagccatgattactttagacctagcccaggcttggaggccagctggaggaagaagggtctaaatcctggcctgtagagttagaactaccatttcctccccttagctgcccttgtatgacccggatttgctatgcaaaacaatctatcccaggttctgttctggttggctacattgttcagcaactcacaaaacgtagcacaaacattcattatggagaaagcatcaggactgttgagtaactcctcctttacttttttcctgctggctacagcatggggtgccctataggcacaagcccagctgaagaacagaatggagggctctgggaggaggcagctcactggagagcctacattccttacacaagtgcctaaagagagtgatgctaacactccatctgccctgtccattgccttcatatacagtctacttcgtgttctgtcaccctttggggaggggagttctcctgggacagtgggctctgcatgttctccacttggatacattttggggctaggatcagggcactattcctggagggtccagtcattcaccagcatttgcaaatgtccatagggagcaggtggcagcctctactcccagcaacaagtttgtgttctctccttttctctctttgcctcactctctccagttggttttcagctggggcttgaaatgcatttttagccctttgacgtggcttatgccattcaagaaataaaaagcaagagaatcagctttgggcaatgacaagaaatgagttcttactctgatttttttgtaaaaagataatttttgagacttgaaaaataccccgaccttgagattattcctgtttgaaaggtggtgcatgcagatggagaagtggtgttggcagcaagctttggctcatgtggatttggtttaagtggtgcttcttacccaagcttcaaggaagtgcttgggggacccccagcctcatcctcttagttgggtctcttgttccctttgtaccactgttttgccttccttttcctcttctctctttgcctggcttcctttcccttttcttctattcactctgcttgcttgctggccggcctgcctgcctgcctgcctgcctgcctgcctgtctgcctatgtgatgatgaaatctctgcatggctgcaatgatcccactgttagctggcagggtcaggcttagctccttgactgcagaagaccaagaacctgttccccaagcccagagatgtccacctgggctggactgccctcaagcttatactagagaagagcaactgacctgcccaacttgtgtgaagtcaggagggtttctggcattttccacacctgtccactccttggagctggtttctctcattgctttttctaaatctggttctttttctctttacctggggcctggcttttctgagattgtcttagggttgagctatttgggtatcctgggtttgagtgttaggggatggacataaaggaaaaagagtgatgagaagagaatggagagaatttgaataaaaggtgggaaaggagagcactgttctttgattgtttatccagtccaacctgatccattagggatcgaggtgctacactggcctccagggataagcctggggctactgttgctgggaacttaggcttaacataaagccgaagaaggtacctagaaatttgaaacttccctaaaaagctcctaatgcccacctgctagatagcttctctgtggcctcctatttagctaagcagcagtgtttttggatactttttttttctgtttgtgaataaggccagcactcaagatgggcagccaagggtgcactgactattagctggcccataggatatctgtaaggctggtgggacagttttggacctggaatcatgtgtaactaacaaggttggacgtttcttccccatcagggtagaaaaatcatctcaaactagccaaaaggcagttttggaaactacattgggggacgttatttttatttatatatggggcctaggccaatccaggatggtagctggaataccttccttcttaaaatctgatcatggcagggatatgcagggcactttttactatttggccttctaagcagattgggaaggaggtattttctggttttcgctttcctccgacttaataggacttgccttctccctgggcagggagagaggctgggttggtgctctcccttactctactcatactgacttagagcctctggctgctgtttgggcatccaagaaagggaggggaaggaatgagctaaaaacaaaacagaatgaggtgggaaagggagattttcttctttacagaggaaaataggaaaccctccaagaattgtgcaagtaaagacatttgttgaatgcactgagtcccttggtgtagtagcaataaggaaaaatgaaattactttcctgtgcacacagtccagcctaattggtatgtgatgttgcacttagcagccatgtggtgggcatgtgtgactactctggttttcactttagtttctaaactttttatccctctcaagtccagcatggatggggaaatgtctctggatccccacagctgtgtacttgtttgcatttgtttccctttgagatttgtgtttgtgtcctgctttgagctgtaccttgtccagtccattgtgaaattatcccagcagctgtaatgtacagttccttctgaagcaagcaacatcagcagcagcagcagcagcagcacaattctgtgttttataaagacaacagtggcttctatttctaaagtgcggtctttctctttttttttcctaccagcaaaacaaacttttgggactgattacatctctaatagattttaggtgagaataatactgtagattgttatgcaggaatacttcacagagccttcatttattcttcattcaacaaacatgcaaagcactgtgccagcagtattgtggggaggggaggcacaattcaaaatgaggaaaatagtgtccgtctcattaagggaattaagtttggtgggggatatgattagccaaatagtcccctggcataggaggaagataatgagggagtggaataaggctacaacaacgaatatagggaggaagggacagatttgagagacgaggtagaattaataggactcgatggctggtgggaggagaagacaggagtagaggttagctcccaggtttctccttgaccataggagtgtgttgggacattctgccagtcaagatgggggtgacggggagactgtagaaggaaggtggggagtttttgaagaaacagaatgttgtatagactgagttttgaggtgtttgtggggcagtaagggtaaggtgtccagtaaacacaggttggtgctcaggtaagactgtaaaactgcatttatagatacaggagtcttatagatggtagttaaagccataggcatgaatgagatagcttagaaaaagagaagagaaactagtatacagccccctaagaaactcaatttaaaggttcgggggaggaagcagatcttaaggtgacagatcactggtagacagtttgtgggttttttgtttctttgtttagccagtttggtgaggtaggagaagaaatcagagtagaagaaggttcatgaagggagtgattaacaacatgaactgctgcagagagggagttctttttttttctgtgtgttttacctttctactccccatcttttggggatcttgtaactctatgacttacttacgttattctccagtatttcttgaaaatgagcattggaaaaaccaattctaaaatggctaaaactaggactttcaagttcaccacaactaccaccaattaggagataattgtaaaagaataaacaaaacctaattttgttcctagccaatattataaaccatgttccagcatactagataatagtagcatactatatttatttccataatttgtcttctttagagcctatgaactcctaggagcagaagctatattctcttcatttttgtcatctcagggtcatggcatataccaacagatcagtatgtgcaaatataattgaaataggctagtagtctgtggtttatgagtatgggctgggtgggcagtggatcaagaagtgataggagtacacaggatgaactcagaattcctgaatcttcaggtaagcagatacttaactacattatcattgtcttttcccactcaccccaagttggaggttctatggttttgtactttaagctggtggtataattgtcaagcatgtaaattctggcattcttcctggtactgctagagcattgttatttctatgcatgggggtaagaaggctcagagaaggatcctggcggataccccagtgagaaatcgtcagtggcagccagtgtgtacatacgtggacctagcattcctctggaggccaagtgttgtaaattggcctgtggctatcatctggcagactcccttgggaaagagccagccagccccatgcttcttttcagcagcaagggttagggaggttggttgaacttgaagagcagattggacatggagcagattttgaccagttgaaataagacataaatttatgactccgagtgaggcagaaataaagaacttagcagggggaataggaggaggatgattatggcaaattttgctataaactttagttttagaaaagattgatattgaaaagccttcaggatttgcctgtggttgctactcaagttaaaaagactgggagcctgcattgtttggtcctggagctcaaggttttcagtgaaggcttgtcctggcacctctgggcattccttttcattactggttgagcatccttccttctgctctgtcaattggcaaaatatgctggagcacattctggactagcagttgccttggggtagtcaggctgggtatttgtttggtatctcttggtgtagcagaccccagaatctcatggcaattaggatttggtggctaaacgaaagagttagtgcaaggaaaagcctagttggaatttctgagtctgggccatccttaagctgctgtctactgcctgaatgggaagtaatgtcgaattggaaaattagctcaccatttttgttctagctttgcagacatttattcctctgatgataggctgagaaatgcctaggccggcttagaaggcacacagcatgacagaagtactccttcaaagcagctgtgtcaagaaggaagagctggaaaagtggatttgctggggaattagatgcatttagttttccacttacgcacaactgccttctccagtatatcataccaaggttttttaggcctttgtggcttaccctgcaggaacatactgtgtcctgttgttctggactgtagcatcttcaccaccatcctcttggcaatggttttttgtttggggtttttttttttttttttttggacaaagtataataatattgagggacctttctagggagcctttggtcctttgtccccattttccaaagggagggaactttcctcttaaaagagacagtgggaacttttagccaggtttttggaaaaggcctgtgggctattaatgagagtgagctgcaaaaggaggaagggtttgtttgggtactttgaagtacttagctaggtgttttctacagtatcttatataattgcatcttacagcatctttacatgcgaaatagtttatcagttatcttcaattgcatattacaaaattctgattaaatttttcttaaataagaaaactatcatttcatatgacaagaaatcctaatttaatgttactccaaggttggttaattcagtggctcagtgataacaccaaagactcagtttcttgaaatttttttgctctgccatcctccatgtttatcctcacgccagttcgcctcatggtcccaatatggctactgtaattctgggaaggaaatgctgacagaaccgtgtctggcaaaagagagacagatttttctgtgtccttctaaagcaaggaagtcttcccctggaagctccaacagatacggcctcatggctttgctagaaatgggtcatctcactcctgtcattggcaaagcaagtaagatcatccatcaggagtggcttagattaatgaattatcctttgagtcgtgtagactagaaagttcagtcatgtctactagcaagaaaggagataagggctgttggataagcagcatctggtctcaaaggtacttcaacttttacagatgagaaacatgaatcagagtgactttcccaggctcacagcaagtaagagagggccttcagtgttagctgtgtctgtccctaaagcccatgttttatattgtatcttgctagagtataaagtaacttactttctaccttgtagaaactgatggtctaggagaagagatttgaactcaggtgcccagttgactctaatcttggcccatgtgagaggattgtactcagttgctctcctcatccagtgatgtttcttgtctaacacaagaagcctaggagtagaaagtcctaagcagagtagaataatagcggcagcagggagggaagtgtgaactgtgtgtccctgagcctgacttactgggcagggacatgacacttaaagcggcagctggccactctgtctttcctgcatgcactgagtatttggtagctcattagtgaccagtgatattgatcatcttttcatgtgctcacttactatccccatatctttgttgtttgcatcttttacccattgtatttgttgtttttgagacagtgtctcactctgtcacccaggctggagtgcagtctcatgatcgcggctcactgcagtttctgcctcctgggctcaagcaatcctcccacctcagcctcctgagtagctgggcttacaggcgcacaccaccatgcccagctaattaaaaaaaaaattttttttgtagcagttcggtctcattagtattgcccaggctggcctctcttagcttcaagctatcctcccgcctcggcctcccaaagtgctggaattacaggcataagccacaagccactgggcccagcctcttttacctgtttcaaaattgagttttattgagttgtaagagttctttattcattttaaacacaagtcctttgttggatatatcttttacatctatttttcccagtctgtggcttgccttttcattttgaagagcaaaagtttaaaattttgtgaatttattaaagctccgtttgttgcttttttctgttctagtttatacttttgtatcatattttaggaaattttgcactgggtatttgatggctcctgaggaggttcaactttcagagcgcactgatttctctgcacctgagattttgtactatttctgtatttctttcttctcagaacaaccagtgtcaccaggtatgagggcagagttttagcttgtttgctgagccccattcttgaagctcatttatttattcacctatctgtccatcaatccaacaaatatactgaatgctgctatgtgccaggtactggcactgttctaggtactggggcaatgacagttaagataatacccaatgaccctgctctgtacccttaagagcagactcagttgggaatgagttatccaaatatagggtgtacatgtagtcaggagagagcctcatacagctttgcctttggcagaatccttcaaacctctttgtcttcctacttcttgatattacaaatcatgagcctttcacatgcattgactctaaagaggtgggttcctggatagcagaagtagataggaaggcatcattgacatttactgagatggattgaatcagagggtgtaaattctgctccatcaatgttgaaaaagactagcccaccccaaaggtttatcactgtcaccatgtctaatgtctattctggaagaagctgaagaagtctgcctttgtttagggaaccggttccagaatcagaggggttgaggatataaaagacccttgcacaagagttggtatttaccctgtcagatgctgctaccaagatttggattgtgtacagtcgaggattaaaaatgacttttaagatgcagtgtttcatctggtgacatttaatttgatattttaaaattggggagggtattttcagccatgggggtagggatgtgaaagaagaagaaagtaagaattggagtcagatgtggttttgagtcccatacatttattgtttaatattatatggtaagtactttaaaatggtaaatagtaaatacttgtgttattcactaacatttggggaggattttctctgtgctttatgtatattacctaaccttacaaactgtgtaaggtacatgctgttctctcaatttttcagataagaaaattgaagcccagagagatcaagtgactgatccaaagtcccacagtgaggggaactgaagataggatattctttctccttttcctctttaaaaaattattttgattaaaaaaaaccgtattactgaagcatagggacatggggagaaattatgaatgattcctcagcctgaataaaatagtatgtttcattaaggcaacaaatatttattaaggacctaatatttgcctgacattcaagtgaggtggggggcacacaagtagtaaataaataacagactgggcaaagggctaccaaggcaatactgtagtagactaacaggtgccccaccatagatgggtggtccggaaaaggcgtctcagatgtctttcgttgagacgcaaaaaaaagctgtggggtagggcgtaaggggagggtggagaagagagagagggttcctggccaagggaaccaaaagcagagaagctccaagtcagaaaaaagcagcggttggcccgttgggagaattggaagccaaccagtatagctgtagcacaggcggggcccatttacgccgtgcgttttcaccctggaaaggagtttgggttttcaagtgtgacgaggcgctattaaagagttttaaacatggaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]