LOCUS       NR_039904                 61 bp    RNA     linear   PRI 19-APR-2022
DEFINITION  Homo sapiens microRNA 4749 (MIR4749), microRNA.
ACCESSION   NR_039904
VERSION     NR_039904.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 61)
  AUTHORS   Botti V, Marrone S, Cannistraro S and Bizzarri AR.
  TITLE     Interaction between miR4749 and Human Serum Albumin as Revealed by
            Fluorescence, FRET, Atomic Force Spectroscopy and Computational
            Modelling
  JOURNAL   Int J Mol Sci 23 (3), 1291 (2022)
   PUBMED   35163220
  REMARK    GeneRIF: Interaction between miR4749 and Human Serum Albumin as
            Revealed by Fluorescence, FRET, Atomic Force Spectroscopy and
            Computational Modelling.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 61)
  AUTHORS   Bizzarri AR and Cannistraro S.
  TITLE     Investigation of a Direct Interaction between miR4749 and the Tumor
            Suppressor p53 by Fluorescence, FRET and Molecular Modeling
  JOURNAL   Biomolecules 10 (2), E346 (2020)
   PUBMED   32098369
  REMARK    GeneRIF: Investigation of a Direct Interaction between miR4749 and
            the Tumor Suppressor p53 by Fluorescence, FRET and Molecular
            Modeling.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 61)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 61)
  AUTHORS   Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
            Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
  TITLE     Identification of new microRNAs in paired normal and tumor breast
            tissue suggests a dual role for the ERBB2/Her2 gene
  JOURNAL   Cancer Res 71 (1), 78-86 (2011)
   PUBMED   21199797
REFERENCE   5  (bases 1 to 61)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   6  (bases 1 to 61)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC018766.2.
            
            On May 30, 2012 this sequence version replaced NR_039904.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611407.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-61                AC018766.2         30096-30156
FEATURES             Location/Qualifiers
     source          1..61
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.33"
     gene            1..61
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /note="microRNA 4749"
                     /db_xref="GeneID:100616313"
                     /db_xref="HGNC:HGNC:41760"
                     /db_xref="miRBase:MI0017388"
     precursor_RNA   1..61
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /product="microRNA 4749"
                     /db_xref="GeneID:100616313"
                     /db_xref="HGNC:HGNC:41760"
                     /db_xref="miRBase:MI0017388"
     exon            1..61
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762281105"
     ncRNA           3..24
                     /ncRNA_class="miRNA"
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /product="hsa-miR-4749-5p"
                     /db_xref="miRBase:MIMAT0019885"
                     /db_xref="GeneID:100616313"
                     /db_xref="HGNC:HGNC:41760"
                     /db_xref="miRBase:MI0017388"
     variation       4
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770355657"
     variation       5
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370929811"
     variation       6
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552910419"
     variation       9
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766523467"
     variation       14
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2074380085"
     variation       15
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751761421"
     variation       17
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759326327"
     variation       20
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2074380413"
     variation       21
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747312801"
     variation       24
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336524397"
     variation       27
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374560183"
     variation       31
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752576001"
     variation       33
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756115404"
     variation       34
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201967614"
     variation       35
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233931883"
     variation       36
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753338524"
     ncRNA           42..61
                     /ncRNA_class="miRNA"
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /product="hsa-miR-4749-3p"
                     /db_xref="miRBase:MIMAT0019886"
                     /db_xref="GeneID:100616313"
                     /db_xref="HGNC:HGNC:41760"
                     /db_xref="miRBase:MI0017388"
     variation       42
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147943327"
     variation       43
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148982635"
     variation       44
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372882504"
     variation       45
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200056596"
     variation       46
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570340094"
     variation       47
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2074381708"
     variation       51
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2074381778"
     variation       52
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568640129"
     variation       53..57
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:778438436"
     variation       53
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2074381968"
     variation       54
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748573000"
     variation       55
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770230641"
     variation       57
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201103722"
     variation       61
                     /gene="MIR4749"
                     /gene_synonym="mir-4749"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2074382441"
ORIGIN      

cctgcggggacaggccagggcatctaggctgtgcacagtgacgcccctcctgcccccacag

//