ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-18 05:52:10, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_039775 61 bp RNA linear PRI 18-JAN-2022
DEFINITION Homo sapiens microRNA 4632 (MIR4632), microRNA.
ACCESSION NR_039775
VERSION NR_039775.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 61)
AUTHORS Tashiro E, Nagasawa Y, Itoh S and Imoto M.
TITLE Involvement of miR-3180-3p and miR-4632-5p in palmitic acid-induced
insulin resistance
JOURNAL Mol Cell Endocrinol 534, 111371 (2021)
PUBMED 34157350
REMARK GeneRIF: Involvement of miR-3180-3p and miR-4632-5p in palmitic
acid-induced insulin resistance.
REFERENCE 2 (bases 1 to 61)
AUTHORS Qian Z, Li Y, Chen J, Li X and Gou D.
TITLE miR-4632 mediates PDGF-BB-induced proliferation and antiapoptosis
of human pulmonary artery smooth muscle cells via targeting cJUN
JOURNAL Am J Physiol Cell Physiol 313 (4), C380-C391 (2017)
PUBMED 28701355
REMARK GeneRIF: Overall, our results suggest that miR-4632 plays an
important role in regulating HPASMC proliferation and apoptosis by
suppression of cJUN, providing a novel therapeutic miRNA candidate
for the treatment of pulmonary vascular remodeling diseases. It
also implies that serum miR-4632 has the potential to serve as a
circulating biomarker for PAH diagnosis.
REFERENCE 3 (bases 1 to 61)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 61)
AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
TITLE Identification of new microRNAs in paired normal and tumor breast
tissue suggests a dual role for the ERBB2/Her2 gene
JOURNAL Cancer Res 71 (1), 78-86 (2011)
PUBMED 21199797
REFERENCE 5 (bases 1 to 61)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL357835.11.
On Dec 4, 2013 this sequence version replaced NR_039775.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-61 AL357835.11 145199-145259
FEATURES Location/Qualifiers
source 1..61
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p36.22"
gene 1..61
/gene="MIR4632"
/note="microRNA 4632"
/db_xref="GeneID:100616438"
/db_xref="HGNC:HGNC:41593"
/db_xref="miRBase:MI0017259"
precursor_RNA 1..61
/gene="MIR4632"
/product="microRNA 4632"
/db_xref="GeneID:100616438"
/db_xref="HGNC:HGNC:41593"
/db_xref="miRBase:MI0017259"
exon 1..61
/gene="MIR4632"
/inference="alignment:Splign:2.1.0"
ncRNA 1..23
/ncRNA_class="miRNA"
/gene="MIR4632"
/product="hsa-miR-4632-5p"
/db_xref="miRBase:MIMAT0022977"
/db_xref="GeneID:100616438"
/db_xref="HGNC:HGNC:41593"
/db_xref="miRBase:MI0017259"
variation 1
/gene="MIR4632"
/replace="g"
/replace="t"
/db_xref="dbSNP:776627969"
variation 3
/gene="MIR4632"
/replace="g"
/replace="t"
/db_xref="dbSNP:2101107412"
variation 4
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285585032"
variation 5
/gene="MIR4632"
/replace="a"
/replace="g"
/db_xref="dbSNP:1356532849"
variation 6
/gene="MIR4632"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639135985"
variation 8
/gene="MIR4632"
/replace="a"
/replace="g"
/db_xref="dbSNP:759820006"
variation 9
/gene="MIR4632"
/replace="c"
/replace="t"
/db_xref="dbSNP:2523668588"
variation 11
/gene="MIR4632"
/replace="a"
/replace="t"
/db_xref="dbSNP:765439526"
variation 13
/gene="MIR4632"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557634190"
variation 14..18
/gene="MIR4632"
/replace="gtgtg"
/replace="gtgtgtg"
/db_xref="dbSNP:776137552"
variation 14
/gene="MIR4632"
/replace="g"
/replace="t"
/db_xref="dbSNP:1459064032"
variation 16
/gene="MIR4632"
/replace="a"
/replace="g"
/db_xref="dbSNP:752962082"
variation 18..26
/gene="MIR4632"
/replace="ggcggaggc"
/replace="ggcggaggcggaggc"
/db_xref="dbSNP:2523668661"
variation 18
/gene="MIR4632"
/replace="a"
/replace="g"
/db_xref="dbSNP:762700397"
variation 19
/gene="MIR4632"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:372784869"
variation 20
/gene="MIR4632"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185774026"
variation 23
/gene="MIR4632"
/replace="a"
/replace="g"
/db_xref="dbSNP:985050720"
variation 24
/gene="MIR4632"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1239443420"
variation 27..28
/gene="MIR4632"
/replace=""
/replace="ag"
/db_xref="dbSNP:2523668685"
variation 29
/gene="MIR4632"
/replace="g"
/replace="t"
/db_xref="dbSNP:2523668695"
variation 30
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:751575604"
variation 31
/gene="MIR4632"
/replace=""
/replace="g"
/db_xref="dbSNP:2523668712"
variation 31
/gene="MIR4632"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757190166"
variation 33
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1380644332"
variation 34
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2523668723"
variation 35
/gene="MIR4632"
/replace="c"
/replace="g"
/db_xref="dbSNP:1421534995"
variation 36
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639137964"
variation 37
/gene="MIR4632"
/replace="c"
/replace="g"
/db_xref="dbSNP:780859909"
variation 39
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:653667"
ncRNA 40..61
/ncRNA_class="miRNA"
/gene="MIR4632"
/product="hsa-miR-4632-3p"
/db_xref="miRBase:MIMAT0019688"
/db_xref="GeneID:100616438"
/db_xref="HGNC:HGNC:41593"
/db_xref="miRBase:MI0017259"
variation 43
/gene="MIR4632"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:372809836"
variation 44
/gene="MIR4632"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1394661716"
variation 46
/gene="MIR4632"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:758783633"
variation 47
/gene="MIR4632"
/replace="a"
/replace="c"
/db_xref="dbSNP:1355726397"
variation 49
/gene="MIR4632"
/replace="c"
/replace="t"
/db_xref="dbSNP:2523668805"
variation 51
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1398967792"
variation 52..57
/gene="MIR4632"
/replace="gctgct"
/replace="gctgctgct"
/db_xref="dbSNP:1639138990"
variation 52
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275801106"
variation 53
/gene="MIR4632"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639139046"
variation 56
/gene="MIR4632"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319361700"
variation 58
/gene="MIR4632"
/replace="c"
/replace="g"
/db_xref="dbSNP:2523668853"
ORIGIN
gagggcagcgtgggtgtggcggaggcaggcgtgaccgtttgccgccctctcgctgctctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]