GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-14 09:11:03, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_039775                 61 bp    RNA     linear   PRI 18-JAN-2022
DEFINITION  Homo sapiens microRNA 4632 (MIR4632), microRNA.
ACCESSION   NR_039775
VERSION     NR_039775.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 61)
  AUTHORS   Tashiro E, Nagasawa Y, Itoh S and Imoto M.
  TITLE     Involvement of miR-3180-3p and miR-4632-5p in palmitic acid-induced
            insulin resistance
  JOURNAL   Mol Cell Endocrinol 534, 111371 (2021)
   PUBMED   34157350
  REMARK    GeneRIF: Involvement of miR-3180-3p and miR-4632-5p in palmitic
            acid-induced insulin resistance.
REFERENCE   2  (bases 1 to 61)
  AUTHORS   Qian Z, Li Y, Chen J, Li X and Gou D.
  TITLE     miR-4632 mediates PDGF-BB-induced proliferation and antiapoptosis
            of human pulmonary artery smooth muscle cells via targeting cJUN
  JOURNAL   Am J Physiol Cell Physiol 313 (4), C380-C391 (2017)
   PUBMED   28701355
  REMARK    GeneRIF: Overall, our results suggest that miR-4632 plays an
            important role in regulating HPASMC proliferation and apoptosis by
            suppression of cJUN, providing a novel therapeutic miRNA candidate
            for the treatment of pulmonary vascular remodeling diseases. It
            also implies that serum miR-4632 has the potential to serve as a
            circulating biomarker for PAH diagnosis.
REFERENCE   3  (bases 1 to 61)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 61)
  AUTHORS   Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
            Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
  TITLE     Identification of new microRNAs in paired normal and tumor breast
            tissue suggests a dual role for the ERBB2/Her2 gene
  JOURNAL   Cancer Res 71 (1), 78-86 (2011)
   PUBMED   21199797
REFERENCE   5  (bases 1 to 61)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL357835.11.
            
            On Dec 4, 2013 this sequence version replaced NR_039775.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-61                AL357835.11        145199-145259
FEATURES             Location/Qualifiers
     source          1..61
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p36.22"
     gene            1..61
                     /gene="MIR4632"
                     /note="microRNA 4632"
                     /db_xref="GeneID:100616438"
                     /db_xref="HGNC:HGNC:41593"
                     /db_xref="miRBase:MI0017259"
     precursor_RNA   1..61
                     /gene="MIR4632"
                     /product="microRNA 4632"
                     /db_xref="GeneID:100616438"
                     /db_xref="HGNC:HGNC:41593"
                     /db_xref="miRBase:MI0017259"
     exon            1..61
                     /gene="MIR4632"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           1..23
                     /ncRNA_class="miRNA"
                     /gene="MIR4632"
                     /product="hsa-miR-4632-5p"
                     /db_xref="miRBase:MIMAT0022977"
                     /db_xref="GeneID:100616438"
                     /db_xref="HGNC:HGNC:41593"
                     /db_xref="miRBase:MI0017259"
     variation       1
                     /gene="MIR4632"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776627969"
     variation       3
                     /gene="MIR4632"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2101107412"
     variation       4
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285585032"
     variation       5
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356532849"
     variation       6
                     /gene="MIR4632"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639135985"
     variation       8
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759820006"
     variation       9
                     /gene="MIR4632"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2523668588"
     variation       11
                     /gene="MIR4632"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765439526"
     variation       13
                     /gene="MIR4632"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557634190"
     variation       14..18
                     /gene="MIR4632"
                     /replace="gtgtg"
                     /replace="gtgtgtg"
                     /db_xref="dbSNP:776137552"
     variation       14
                     /gene="MIR4632"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1459064032"
     variation       16
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752962082"
     variation       18..26
                     /gene="MIR4632"
                     /replace="ggcggaggc"
                     /replace="ggcggaggcggaggc"
                     /db_xref="dbSNP:2523668661"
     variation       18
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762700397"
     variation       19
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372784869"
     variation       20
                     /gene="MIR4632"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185774026"
     variation       23
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985050720"
     variation       24
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239443420"
     variation       27..28
                     /gene="MIR4632"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:2523668685"
     variation       29
                     /gene="MIR4632"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2523668695"
     variation       30
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751575604"
     variation       31
                     /gene="MIR4632"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:2523668712"
     variation       31
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757190166"
     variation       33
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380644332"
     variation       34
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2523668723"
     variation       35
                     /gene="MIR4632"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421534995"
     variation       36
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639137964"
     variation       37
                     /gene="MIR4632"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780859909"
     variation       39
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:653667"
     ncRNA           40..61
                     /ncRNA_class="miRNA"
                     /gene="MIR4632"
                     /product="hsa-miR-4632-3p"
                     /db_xref="miRBase:MIMAT0019688"
                     /db_xref="GeneID:100616438"
                     /db_xref="HGNC:HGNC:41593"
                     /db_xref="miRBase:MI0017259"
     variation       43
                     /gene="MIR4632"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372809836"
     variation       44
                     /gene="MIR4632"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394661716"
     variation       46
                     /gene="MIR4632"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758783633"
     variation       47
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355726397"
     variation       49
                     /gene="MIR4632"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2523668805"
     variation       51
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398967792"
     variation       52..57
                     /gene="MIR4632"
                     /replace="gctgct"
                     /replace="gctgctgct"
                     /db_xref="dbSNP:1639138990"
     variation       52
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275801106"
     variation       53
                     /gene="MIR4632"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639139046"
     variation       56
                     /gene="MIR4632"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319361700"
     variation       58
                     /gene="MIR4632"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2523668853"
ORIGIN      
gagggcagcgtgggtgtggcggaggcaggcgtgaccgtttgccgccctctcgctgctctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]