2025-10-18 18:03:43, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_039775 61 bp RNA linear PRI 18-JAN-2022 DEFINITION Homo sapiens microRNA 4632 (MIR4632), microRNA. ACCESSION NR_039775 VERSION NR_039775.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 61) AUTHORS Tashiro E, Nagasawa Y, Itoh S and Imoto M. TITLE Involvement of miR-3180-3p and miR-4632-5p in palmitic acid-induced insulin resistance JOURNAL Mol Cell Endocrinol 534, 111371 (2021) PUBMED 34157350 REMARK GeneRIF: Involvement of miR-3180-3p and miR-4632-5p in palmitic acid-induced insulin resistance. REFERENCE 2 (bases 1 to 61) AUTHORS Qian Z, Li Y, Chen J, Li X and Gou D. TITLE miR-4632 mediates PDGF-BB-induced proliferation and antiapoptosis of human pulmonary artery smooth muscle cells via targeting cJUN JOURNAL Am J Physiol Cell Physiol 313 (4), C380-C391 (2017) PUBMED 28701355 REMARK GeneRIF: Overall, our results suggest that miR-4632 plays an important role in regulating HPASMC proliferation and apoptosis by suppression of cJUN, providing a novel therapeutic miRNA candidate for the treatment of pulmonary vascular remodeling diseases. It also implies that serum miR-4632 has the potential to serve as a circulating biomarker for PAH diagnosis. REFERENCE 3 (bases 1 to 61) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 61) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 5 (bases 1 to 61) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL357835.11. On Dec 4, 2013 this sequence version replaced NR_039775.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-61 AL357835.11 145199-145259 FEATURES Location/Qualifiers source 1..61 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="1" /map="1p36.22" gene 1..61 /gene="MIR4632" /note="microRNA 4632" /db_xref="GeneID:100616438" /db_xref="HGNC:HGNC:41593" /db_xref="miRBase:MI0017259" precursor_RNA 1..61 /gene="MIR4632" /product="microRNA 4632" /db_xref="GeneID:100616438" /db_xref="HGNC:HGNC:41593" /db_xref="miRBase:MI0017259" exon 1..61 /gene="MIR4632" /inference="alignment:Splign:2.1.0" ncRNA 1..23 /ncRNA_class="miRNA" /gene="MIR4632" /product="hsa-miR-4632-5p" /db_xref="miRBase:MIMAT0022977" /db_xref="GeneID:100616438" /db_xref="HGNC:HGNC:41593" /db_xref="miRBase:MI0017259" variation 1 /gene="MIR4632" /replace="g" /replace="t" /db_xref="dbSNP:776627969" variation 3 /gene="MIR4632" /replace="g" /replace="t" /db_xref="dbSNP:2101107412" variation 4 /gene="MIR4632" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1285585032" variation 5 /gene="MIR4632" /replace="a" /replace="g" /db_xref="dbSNP:1356532849" variation 6 /gene="MIR4632" /replace="c" /replace="t" /db_xref="dbSNP:1639135985" variation 8 /gene="MIR4632" /replace="a" /replace="g" /db_xref="dbSNP:759820006" variation 9 /gene="MIR4632" /replace="c" /replace="t" /db_xref="dbSNP:2523668588" variation 11 /gene="MIR4632" /replace="a" /replace="t" /db_xref="dbSNP:765439526" variation 13 /gene="MIR4632" /replace="g" /replace="t" /db_xref="dbSNP:1557634190" variation 14..18 /gene="MIR4632" /replace="gtgtg" /replace="gtgtgtg" /db_xref="dbSNP:776137552" variation 14 /gene="MIR4632" /replace="g" /replace="t" /db_xref="dbSNP:1459064032" variation 16 /gene="MIR4632" /replace="a" /replace="g" /db_xref="dbSNP:752962082" variation 18..26 /gene="MIR4632" /replace="ggcggaggc" /replace="ggcggaggcggaggc" /db_xref="dbSNP:2523668661" variation 18 /gene="MIR4632" /replace="a" /replace="g" /db_xref="dbSNP:762700397" variation 19 /gene="MIR4632" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:372784869" variation 20 /gene="MIR4632" /replace="c" /replace="t" /db_xref="dbSNP:1185774026" variation 23 /gene="MIR4632" /replace="a" /replace="g" /db_xref="dbSNP:985050720" variation 24 /gene="MIR4632" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1239443420" variation 27..28 /gene="MIR4632" /replace="" /replace="ag" /db_xref="dbSNP:2523668685" variation 29 /gene="MIR4632" /replace="g" /replace="t" /db_xref="dbSNP:2523668695" variation 30 /gene="MIR4632" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:751575604" variation 31 /gene="MIR4632" /replace="" /replace="g" /db_xref="dbSNP:2523668712" variation 31 /gene="MIR4632" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:757190166" variation 33 /gene="MIR4632" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1380644332" variation 34 /gene="MIR4632" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:2523668723" variation 35 /gene="MIR4632" /replace="c" /replace="g" /db_xref="dbSNP:1421534995" variation 36 /gene="MIR4632" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1639137964" variation 37 /gene="MIR4632" /replace="c" /replace="g" /db_xref="dbSNP:780859909" variation 39 /gene="MIR4632" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:653667" ncRNA 40..61 /ncRNA_class="miRNA" /gene="MIR4632" /product="hsa-miR-4632-3p" /db_xref="miRBase:MIMAT0019688" /db_xref="GeneID:100616438" /db_xref="HGNC:HGNC:41593" /db_xref="miRBase:MI0017259" variation 43 /gene="MIR4632" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:372809836" variation 44 /gene="MIR4632" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1394661716" variation 46 /gene="MIR4632" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:758783633" variation 47 /gene="MIR4632" /replace="a" /replace="c" /db_xref="dbSNP:1355726397" variation 49 /gene="MIR4632" /replace="c" /replace="t" /db_xref="dbSNP:2523668805" variation 51 /gene="MIR4632" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1398967792" variation 52..57 /gene="MIR4632" /replace="gctgct" /replace="gctgctgct" /db_xref="dbSNP:1639138990" variation 52 /gene="MIR4632" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1275801106" variation 53 /gene="MIR4632" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1639139046" variation 56 /gene="MIR4632" /replace="c" /replace="t" /db_xref="dbSNP:1319361700" variation 58 /gene="MIR4632" /replace="c" /replace="g" /db_xref="dbSNP:2523668853" ORIGIN
gagggcagcgtgggtgtggcggaggcaggcgtgaccgtttgccgccctctcgctgctctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]