LOCUS       NR_039729                 84 bp    RNA     linear   PRI 31-JUL-2023
DEFINITION  Homo sapiens microRNA 2392 (MIR2392), microRNA.
ACCESSION   NR_039729
VERSION     NR_039729.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 84)
  AUTHORS   Aalikhani M, Alikhani M, Khajeniazi S, Khosravi A, Bazi Z and
            Kianmehr A.
  TITLE     Positive effect of miR-2392 on fibroblast to cardiomyocyte-like
            cell fate transition: An in silico and in vitro study
  JOURNAL   Gene 879, 147598 (2023)
   PUBMED   37393060
  REMARK    GeneRIF: Positive effect of miR-2392 on fibroblast to
            cardiomyocyte-like cell fate transition: An in silico and in vitro
            study.
REFERENCE   2  (bases 1 to 84)
  AUTHORS   Sun B, Ji W, Liu C, Lin X, Chen L, Qian H and Su C.
  TITLE     miR-2392 functions as tumour suppressor and inhibits malignant
            progression of hepatocellular carcinoma via directly targeting JAG2
  JOURNAL   Liver Int 42 (7), 1658-1673 (2022)
   PUBMED   35485355
  REMARK    GeneRIF: miR-2392 functions as tumour suppressor and inhibits
            malignant progression of hepatocellular carcinoma via directly
            targeting JAG2.
REFERENCE   3  (bases 1 to 84)
  AUTHORS   McDonald JT, Enguita FJ, Taylor D, Griffin RJ, Priebe W, Emmett MR,
            Sajadi MM, Harris AD, Clement J, Dybas JM, Aykin-Burns N, Guarnieri
            JW, Singh LN, Grabham P, Baylin SB, Yousey A, Pearson AN, Corry PM,
            Saravia-Butler A, Aunins TR, Sharma S, Nagpal P, Meydan C, Foox J,
            Mozsary C, Cerqueira B, Zaksas V, Singh U, Wurtele ES, Costes SV,
            Davanzo GG, Galeano D, Paccanaro A, Meinig SL, Hagan RS, Bowman NM,
            Wolfgang MC, Altinok S, Sapoval N, Treangen TJ, Moraes-Vieira PM,
            Vanderburg C, Wallace DC, Schisler JC, Mason CE, Chatterjee A,
            Meller R and Beheshti A.
  CONSRTM   UNC COVID-19 Pathobiology Consortium
  TITLE     Role of miR-2392 in driving SARS-CoV-2 infection
  JOURNAL   Cell Rep 37 (3), 109839 (2021)
   PUBMED   34624208
  REMARK    GeneRIF: Role of miR-2392 in driving SARS-CoV-2 infection.
REFERENCE   4  (bases 1 to 84)
  AUTHORS   Hou Z, Fan F and Liu P.
  TITLE     BTXA regulates the epithelial-mesenchymal transition and autophagy
            of keloid fibroblasts via modulating miR-1587/miR-2392 targeted
            ZEB2
  JOURNAL   Biosci Rep 39 (10) (2019)
   PUBMED   31652445
  REMARK    GeneRIF: BTXA regulates the epithelial-mesenchymal transition and
            autophagy of keloid fibroblasts via modulating miR-1587/miR-2392
            targeted ZEB2.
REFERENCE   5  (bases 1 to 84)
  AUTHORS   Yang J, Li C, Li H and E C.
  TITLE     LncRNA CACNA1G-AS1 facilitates hepatocellular carcinoma progression
            through the miR-2392/C1orf61 pathway
  JOURNAL   J Cell Physiol 234 (10), 18415-18422 (2019)
   PUBMED   30908634
  REMARK    GeneRIF: CACNA1G-AS1 promotes hepatocellular carcinoma progression
            through regulating the miR-2392/C1orf61 pathway.
REFERENCE   6  (bases 1 to 84)
  AUTHORS   Li J, Li T, Lu Y, Shen G, Guo H, Wu J, Lei C, Du F, Zhou F, Zhao X,
            Nie Y and Fan D.
  TITLE     MiR-2392 suppresses metastasis and epithelial-mesenchymal
            transition by targeting MAML3 and WHSC1 in gastric cancer
  JOURNAL   FASEB J 31 (9), 3774-3786 (2017)
   PUBMED   28512191
  REMARK    GeneRIF: These findings indicate that the
            miR-2392-MAML3/WHSC1-Slug/Twist1 regulatory axis plays a critical
            role in GC metastasis.
REFERENCE   7  (bases 1 to 84)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 84)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   9  (bases 1 to 84)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL117190.6.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-84                AL117190.6         54607-54690
FEATURES             Location/Qualifiers
     source          1..84
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q32.2"
     gene            1..84
                     /gene="MIR2392"
                     /note="microRNA 2392"
                     /db_xref="GeneID:100616495"
                     /db_xref="HGNC:HGNC:41843"
                     /db_xref="miRBase:MI0016870"
     precursor_RNA   1..84
                     /gene="MIR2392"
                     /product="microRNA 2392"
                     /db_xref="GeneID:100616495"
                     /db_xref="HGNC:HGNC:41843"
                     /db_xref="miRBase:MI0016870"
     exon            1..84
                     /gene="MIR2392"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558004045"
     variation       9
                     /gene="MIR2392"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:2139913660"
     variation       9
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1595240852"
     variation       10
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2139913661"
     variation       13
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367312817"
     variation       14
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182974078"
     variation       15
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1595240863"
     variation       22
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480254330"
     variation       23
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2037087052"
     variation       25
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2037087073"
     variation       26
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917382033"
     variation       28
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2139913676"
     variation       29
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73347569"
     variation       32
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557023035"
     variation       33
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997221201"
     variation       34
                     /gene="MIR2392"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1250435089"
     variation       37
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2037087263"
     variation       38
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2037087286"
     variation       39
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2037087314"
     variation       42
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259174581"
     variation       44
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044641262"
     variation       45
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206095780"
     variation       46
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266535249"
     variation       51
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259479156"
     variation       52
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218841974"
     variation       53
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250234556"
     variation       54
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576509898"
     variation       57
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272853344"
     variation       58
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779172086"
     ncRNA           61..80
                     /ncRNA_class="miRNA"
                     /gene="MIR2392"
                     /product="hsa-miR-2392"
                     /db_xref="miRBase:MIMAT0019043"
                     /db_xref="GeneID:100616495"
                     /db_xref="HGNC:HGNC:41843"
                     /db_xref="miRBase:MI0016870"
     variation       61
                     /gene="MIR2392"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193524402"
     variation       62
                     /gene="MIR2392"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:2139913704"
     variation       63..64
                     /gene="MIR2392"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:2037087567"
     variation       64
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235148713"
     variation       65
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:118055959"
     variation       67
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566709192"
     variation       71
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1595240889"
     variation       72
                     /gene="MIR2392"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1595240892"
     variation       77
                     /gene="MIR2392"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761601922"
     variation       80
                     /gene="MIR2392"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402511503"
     variation       81
                     /gene="MIR2392"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2037087734"
     variation       82
                     /gene="MIR2392"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:2139913722"
ORIGIN      

atggtccctcccaatccagccattcctcagaccaggtggctcccgagccaccccaggctgtaggatgggggtgagaggtgctag

//