LOCUS       NR_039687                 70 bp    RNA     linear   PRI 04-SEP-2020
DEFINITION  Homo sapiens microRNA 4476 (MIR4476), microRNA.
ACCESSION   NR_039687
VERSION     NR_039687.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 70)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 70)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res. 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   3  (bases 1 to 70)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   4  (bases 1 to 70)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL450267.10.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611317.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-70                AL450267.10        111154-111223       c
FEATURES             Location/Qualifiers
     source          1..70
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="9"
                     /map="9p13.2"
     gene            1..70
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /note="microRNA 4476"
                     /db_xref="GeneID:100616456"
                     /db_xref="HGNC:HGNC:41793"
                     /db_xref="miRBase:MI0016828"
     precursor_RNA   1..70
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /product="microRNA 4476"
                     /db_xref="GeneID:100616456"
                     /db_xref="HGNC:HGNC:41793"
                     /db_xref="miRBase:MI0016828"
     exon            1..70
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /inference="alignment:Splign:2.1.0"
     variation       5
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2131825174"
     variation       8
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461511671"
     variation       9
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1827583158"
     variation       22
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1827582664"
     variation       25
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188233723"
     variation       27
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1827582278"
     variation       28
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563939607"
     variation       29
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1392800732"
     variation       35
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326452833"
     variation       41
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464670807"
     ncRNA           45..66
                     /ncRNA_class="miRNA"
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /product="hsa-miR-4476"
                     /db_xref="miRBase:MIMAT0019003"
                     /db_xref="GeneID:100616456"
                     /db_xref="HGNC:HGNC:41793"
                     /db_xref="miRBase:MI0016828"
     variation       47
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978640498"
     variation       48
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1827580567"
     variation       50
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019792440"
     variation       51
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1827579972"
     variation       54
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2131824984"
     variation       58
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1587893061"
     variation       60
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1563939578"
     variation       66
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008364367"
     variation       67
                     /gene="MIR4476"
                     /gene_synonym="mir-4476"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563939566"
ORIGIN      

aaaagcctgtccctaagtccctcccagccttccagagttggtgccaggaaggatttagggacaggctttg

//