LOCUS       NR_039609                 79 bp    RNA     linear   PRI 17-MAY-2020
DEFINITION  Homo sapiens microRNA 378e (MIR378E), microRNA.
ACCESSION   NR_039609
VERSION     NR_039609.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 79)
  AUTHORS   Ding C, Wu Z, You H, Ge H, Zheng S, Lin Y, Wu X, Lin Z and Kang D.
  TITLE     CircNFIX promotes progression of glioma through regulating
            miR-378e/RPN2 axis
  JOURNAL   J. Exp. Clin. Cancer Res. 38 (1), 506 (2019)
   PUBMED   31888753
  REMARK    GeneRIF: Knockdown of circNFIX inhibits progression of glioma in
            vitro and in vivo by increasing miR-378e and decreasing RPN2,
            providing a novel mechanism for understanding the pathogenesis of
            glioma.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 79)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 79)
  AUTHORS   Navarini AA, Simpson MA, Weale M, Knight J, Carlavan I, Reiniche P,
            Burden DA, Layton A, Bataille V, Allen M, Pleass R, Pink A, Creamer
            D, English J, Munn S, Walton S, Willis C, Deret S, Voegel JJ,
            Spector T, Smith CH, Trembath RC and Barker JN.
  CONSRTM   Acne Genetic Study Group
  TITLE     Genome-wide association study identifies three novel susceptibility
            loci for severe Acne vulgaris
  JOURNAL   Nat Commun 5, 4020 (2014)
   PUBMED   24927181
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 79)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res. 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   5  (bases 1 to 79)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   6  (bases 1 to 79)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC026695.5.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611276.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-79                AC026695.5         80568-80646         c
FEATURES             Location/Qualifiers
     source          1..79
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q35.1"
     gene            1..79
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /note="microRNA 378e"
                     /db_xref="GeneID:100616498"
                     /db_xref="HGNC:HGNC:41671"
                     /db_xref="miRBase:MI0016750"
     precursor_RNA   1..79
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /product="microRNA 378e"
                     /db_xref="GeneID:100616498"
                     /db_xref="HGNC:HGNC:41671"
                     /db_xref="miRBase:MI0016750"
     exon            1..79
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017552447"
     variation       10
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1756005195"
     variation       11
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367764573"
     variation       23
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1756005510"
     variation       24
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1756005619"
     variation       25
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887357721"
     variation       26
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1756005876"
     variation       29
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978649817"
     variation       30
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1756006068"
     variation       34
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1756006186"
     variation       43
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1756006325"
     variation       48
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371300444"
     variation       49
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:955832869"
     variation       50
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992890475"
     ncRNA           58..76
                     /ncRNA_class="miRNA"
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /product="hsa-miR-378e"
                     /db_xref="miRBase:MIMAT0018927"
                     /db_xref="GeneID:100616498"
                     /db_xref="HGNC:HGNC:41671"
                     /db_xref="miRBase:MI0016750"
     variation       59
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1756006863"
     variation       60
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376752141"
     variation       63
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1756007079"
     variation       64
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1756007177"
     variation       67
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1756007301"
     variation       68
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298291117"
     variation       72
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1756007454"
     variation       73
                     /gene="MIR378E"
                     /gene_synonym="mir-378e"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2113831952"
ORIGIN      

ctgactccagtgtccaggccaggggcagacagtggacagagaacagtgcccaagaccactggacttggagtcaggacat

//