LOCUS       NR_039601                 96 bp    RNA     linear   PRI 22-AUG-2022
DEFINITION  Homo sapiens microRNA 151b (MIR151B), microRNA.
ACCESSION   NR_039601
VERSION     NR_039601.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 96)
  AUTHORS   Dong Q, Dong L, Zhu Y, Wang X, Li Z and Zhang L.
  TITLE     Circular ribonucleic acid nucleoporin 98 knockdown alleviates high
            glucose-induced proliferation, fibrosis, inflammation and oxidative
            stress in human glomerular mesangial cells by regulating the
            microribonucleic acid-151-3p-high mobility group AT-hook 2 axis
  JOURNAL   J Diabetes Investig 13 (8), 1303-1315 (2022)
   PUBMED   35482475
  REMARK    GeneRIF: Circular ribonucleic acid nucleoporin 98 knockdown
            alleviates high glucose-induced proliferation, fibrosis,
            inflammation and oxidative stress in human glomerular mesangial
            cells by regulating the microribonucleic acid-151-3p-high mobility
            group AT-hook 2 axis.
REFERENCE   2  (bases 1 to 96)
  AUTHORS   Huang K, Liu D and Su C.
  TITLE     Circ_0007841 accelerates ovarian cancer development through
            facilitating MEX3C expression by restraining miR-151-3p activity
  JOURNAL   Aging (Albany NY) 13 (8), 12058-12066 (2021)
   PUBMED   33896797
  REMARK    GeneRIF: Circ_0007841 accelerates ovarian cancer development
            through facilitating MEX3C expression by restraining miR-151-3p
            activity.
REFERENCE   3  (bases 1 to 96)
  AUTHORS   Cheng X, Kan P, Ma Z, Wang Y, Song W, Huang C and Zhang B.
  TITLE     Exploring the potential value of miR-148b-3p, miR-151b and
            miR-27b-3p as biomarkers in acute ischemic stroke
  JOURNAL   Biosci Rep 38 (6) (2018)
   PUBMED   30361294
  REMARK    GeneRIF: Blood miR-151b level was negatively correlated with
            insulin-like growth factor-1 (IGF-1), and miR-27b-3p level was
            negatively correlated with IGF-1 and insulin-like growth factor
            binding protein-3, respectively. Our findings suggest that
            miR-148b-3p, miR-151b and miR-27b-3p may serve as blood-based
            biomarkers for diagnosing ischemic stroke patients, and the
            combination of miR-148b-3p and miR-27b-3p may be more powerful
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 96)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 96)
  AUTHORS   Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner
            R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu
            R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis
            E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF and Mayr M.
  TITLE     Association of MicroRNAs and YRNAs With Platelet Function
  JOURNAL   Circ Res 118 (3), 420-432 (2016)
   PUBMED   26646931
REFERENCE   6  (bases 1 to 96)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   7  (bases 1 to 96)
  AUTHORS   Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
            Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
            Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
  TITLE     Many novel mammalian microRNA candidates identified by extensive
            cloning and RAKE analysis
  JOURNAL   Genome Res 16 (10), 1289-1298 (2006)
   PUBMED   16954537
REFERENCE   8  (bases 1 to 96)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL133523.5.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-96                AL133523.5         46944-47039         c
FEATURES             Location/Qualifiers
     source          1..96
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q32.2"
     gene            1..96
                     /gene="MIR151B"
                     /note="microRNA 151b"
                     /db_xref="GeneID:100616247"
                     /db_xref="HGNC:HGNC:41588"
                     /db_xref="miRBase:MI0003772"
     precursor_RNA   1..96
                     /gene="MIR151B"
                     /product="microRNA 151b"
                     /db_xref="GeneID:100616247"
                     /db_xref="HGNC:HGNC:41588"
                     /db_xref="miRBase:MI0003772"
     exon            1..96
                     /gene="MIR151B"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185548105"
     variation       4
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448738453"
     variation       10
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262359333"
     variation       12
                     /gene="MIR151B"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1886809302"
     variation       15
                     /gene="MIR151B"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1326987127"
     variation       15
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204545537"
     variation       16
                     /gene="MIR151B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1886808507"
     variation       17
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274854663"
     variation       18
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025717145"
     variation       20
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566702830"
     variation       22
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1886807559"
     variation       34
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544043099"
     variation       35
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290986494"
     variation       41
                     /gene="MIR151B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432305247"
     variation       42
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1886806849"
     variation       49
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326567589"
     variation       53..61
                     /gene="MIR151B"
                     /replace=""
                     /replace="cctgccctc"
                     /db_xref="dbSNP:1566702802"
     variation       53
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317020330"
     variation       57
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920667244"
     variation       58
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1886805794"
     variation       59
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382198461"
     ncRNA           60..77
                     /ncRNA_class="miRNA"
                     /gene="MIR151B"
                     /product="hsa-miR-151b"
                     /db_xref="miRBase:MIMAT0010214"
                     /db_xref="GeneID:100616247"
                     /db_xref="HGNC:HGNC:41588"
                     /db_xref="miRBase:MI0003772"
     variation       61
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530616727"
     variation       62
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447689330"
     variation       67
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1886804673"
     variation       75
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167577108"
     variation       76
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1886804079"
     variation       79
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1886803843"
     variation       80..89
                     /gene="MIR151B"
                     /replace="acaaac"
                     /replace="acaaacaaac"
                     /db_xref="dbSNP:1395702225"
     variation       81
                     /gene="MIR151B"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962702855"
     variation       83
                     /gene="MIR151B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1886803290"
     variation       86
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018251166"
     variation       90
                     /gene="MIR151B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564864187"
     variation       91
                     /gene="MIR151B"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189669291"
ORIGIN      

acctctgatgtgtcagtctctcttcagggctcccgagacacagaaacagacacctgccctcgaggagctcacagtctagacaaacaaacccagggt

//