LOCUS       NR_037410                 92 bp    RNA     linear   PRI 11-SEP-2020
DEFINITION  Homo sapiens microRNA 3616 (MIR3616), microRNA.
ACCESSION   NR_037410
VERSION     NR_037410.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 92)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 92)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res. 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   3  (bases 1 to 92)
  AUTHORS   Witten D, Tibshirani R, Gu SG, Fire A and Lui WO.
  TITLE     Ultra-high throughput sequencing-based small RNA discovery and
            discrete statistical biomarker analysis in a collection of cervical
            tumours and matched controls
  JOURNAL   BMC Biol. 8, 58 (2010)
   PUBMED   20459774
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 92)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL022342.7.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611175.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-92                AL022342.7         41675-41766
FEATURES             Location/Qualifiers
     source          1..92
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20q13.12"
     gene            1..92
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /note="microRNA 3616"
                     /db_xref="GeneID:100500814"
                     /db_xref="HGNC:HGNC:38943"
                     /db_xref="miRBase:MI0016006"
     precursor_RNA   1..92
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /product="microRNA 3616"
                     /db_xref="GeneID:100500814"
                     /db_xref="HGNC:HGNC:38943"
                     /db_xref="miRBase:MI0016006"
     exon            1..92
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /inference="alignment:Splign:2.1.0"
     variation       9
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285738651"
     variation       10
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192179398"
     variation       12
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2146645259"
     variation       13
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2146645267"
     variation       16
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753430018"
     ncRNA           19..40
                     /ncRNA_class="miRNA"
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /product="hsa-miR-3616-5p"
                     /db_xref="miRBase:MIMAT0017995"
                     /db_xref="GeneID:100500814"
                     /db_xref="HGNC:HGNC:38943"
                     /db_xref="miRBase:MI0016006"
     variation       23
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2034211482"
     variation       25
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2034211536"
     variation       27
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2034211588"
     variation       28
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1600763037"
     variation       29
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2034211714"
     variation       31
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576379844"
     variation       32
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757683299"
     variation       33
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600763051"
     variation       34
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2034211968"
     variation       35
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2034212029"
     variation       37
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258362367"
     variation       38
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765803807"
     variation       39
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046675950"
     variation       52
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2034212239"
     variation       54
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557286910"
     ncRNA           60..82
                     /ncRNA_class="miRNA"
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /product="hsa-miR-3616-3p"
                     /db_xref="miRBase:MIMAT0017996"
                     /db_xref="GeneID:100500814"
                     /db_xref="HGNC:HGNC:38943"
                     /db_xref="miRBase:MI0016006"
     variation       60
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2034212369"
     variation       61
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241656567"
     variation       62
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:2034212488"
     variation       65
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2146645335"
     variation       67
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336777739"
     variation       71
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2034212581"
     variation       72
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288261512"
     variation       76
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2146645350"
     variation       80
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750749182"
     variation       82
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751652021"
     variation       83
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532889629"
     variation       85
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2034212937"
     variation       87
                     /gene="MIR3616"
                     /gene_synonym="mir-3616"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005886100"
ORIGIN      

tgtcactccgccagcatcatgaagtgcactcatgatatgtttgccccatcagcgtgtcacgagggcatttcatgatgcaggcggggttggca

//