LOCUS       NR_036211                 86 bp    RNA     linear   PRI 10-JUL-2022
DEFINITION  Homo sapiens microRNA 4257 (MIR4257), microRNA.
ACCESSION   NR_036211
VERSION     NR_036211.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 86)
  AUTHORS   Kataoka S, Arita T, Konishi H, Yamamoto Y, Shibata R, Yamamoto T,
            Shibamoto J, Furuke H, Takabatake K, Takaki W, Kiuchi J, Shimizu H,
            Komatsu S, Shiozaki A, Kuriu Y and Otsuji E.
  TITLE     The Role of Inflammation-associated microRNA-4257 as a Promoter of
            Malignancy in Colorectal Cancer
  JOURNAL   Anticancer Res 42 (7), 3349-3360 (2022)
   PUBMED   35790263
  REMARK    GeneRIF: The Role of Inflammation-associated microRNA-4257 as a
            Promoter of Malignancy in Colorectal Cancer.
REFERENCE   2  (bases 1 to 86)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 86)
  AUTHORS   Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and
            Hart RP.
  TITLE     Ago2 immunoprecipitation identifies predicted microRNAs in human
            embryonic stem cells and neural precursors
  JOURNAL   PLoS One 4 (9), e7192 (2009)
   PUBMED   19784364
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 86)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL356356.17.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-86                AL356356.17        79191-79276
FEATURES             Location/Qualifiers
     source          1..86
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q21.2"
     gene            1..86
                     /gene="MIR4257"
                     /note="microRNA 4257"
                     /db_xref="GeneID:100422997"
                     /db_xref="HGNC:HGNC:38312"
                     /db_xref="miRBase:MI0015856"
     precursor_RNA   1..86
                     /gene="MIR4257"
                     /product="microRNA 4257"
                     /db_xref="GeneID:100422997"
                     /db_xref="HGNC:HGNC:38312"
                     /db_xref="miRBase:MI0015856"
     exon            1..86
                     /gene="MIR4257"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186779877"
     variation       4..5
                     /gene="MIR4257"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:2101550629"
     variation       4
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2101550588"
     variation       10
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1570917867"
     variation       15
                     /gene="MIR4257"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1041627961"
     variation       16
                     /gene="MIR4257"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1671451068"
     variation       22
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903136375"
     variation       23
                     /gene="MIR4257"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000118867"
     variation       28
                     /gene="MIR4257"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1299078981"
     variation       35
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006295434"
     variation       40
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183813781"
     variation       41..46
                     /gene="MIR4257"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:1671453229"
     variation       45..58
                     /gene="MIR4257"
                     /replace=""
                     /replace="agcccctacagggc"
                     /db_xref="dbSNP:1350314446"
     variation       46
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015936176"
     variation       47
                     /gene="MIR4257"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1671454192"
     variation       48
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560283241"
     variation       49
                     /gene="MIR4257"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1292239766"
     variation       53
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393344561"
     variation       54
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900376298"
     variation       55
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387778139"
     ncRNA           59..76
                     /ncRNA_class="miRNA"
                     /gene="MIR4257"
                     /product="hsa-miR-4257"
                     /db_xref="miRBase:MIMAT0016878"
                     /db_xref="GeneID:100422997"
                     /db_xref="HGNC:HGNC:38312"
                     /db_xref="miRBase:MI0015856"
     variation       60
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1671455946"
     variation       62
                     /gene="MIR4257"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2101551407"
     variation       64
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74743733"
     variation       65
                     /gene="MIR4257"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338780840"
     variation       74
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221318744"
     variation       76
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322687799"
     variation       77
                     /gene="MIR4257"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1671457579"
     variation       78
                     /gene="MIR4257"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963860752"
     variation       82
                     /gene="MIR4257"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1671458317"
     variation       85..86
                     /gene="MIR4257"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1671458626"
ORIGIN      

ggcttagaaacagtccctaggtaggatttggggaggagctaagaagcccctacagggcccagaggtggggactgagccttagttgg

//