LOCUS       NR_036181                 78 bp    RNA     linear   PRI 19-APR-2022
DEFINITION  Homo sapiens microRNA 4293 (MIR4293), microRNA.
ACCESSION   NR_036181
VERSION     NR_036181.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 78)
  AUTHORS   Suetsugu H, Kim K, Yamamoto T, Bang SY, Sakamoto Y, Shin JM, Sugano
            N, Kim JS, Mukai M, Lee YK, Ohmura K, Park DJ, Takahashi D, Ahn GY,
            Karino K, Kwon YC, Miyamura T, Kim J, Nakamura J, Motomura G,
            Kuroda T, Niiro H, Miyamoto T, Takeuchi T, Ikari K, Amano K, Tada
            Y, Yamaji K, Shimizu M, Atsumi T, Seki T, Tanaka Y, Kubo T, Hisada
            R, Yoshioka T, Yamazaki M, Kabata T, Kajino T, Ohta Y, Okawa T,
            Naito Y, Kaneuji A, Yasunaga Y, Ohzono K, Tomizuka K, Koido M,
            Matsuda K, Okada Y, Suzuki A, Kim BJ, Kochi Y, Lee HS, Ikegawa S,
            Bae SC and Terao C.
  TITLE     Novel susceptibility loci for steroid-associated osteonecrosis of
            the femoral head in systemic lupus erythematosus
  JOURNAL   Hum Mol Genet 31 (7), 1082-1095 (2022)
   PUBMED   34850884
  REMARK    GeneRIF: Novel susceptibility loci for steroid-associated
            osteonecrosis of the femoral head in systemic lupus erythematosus.
REFERENCE   2  (bases 1 to 78)
  AUTHORS   Zhang Q, Yan YF, Lv Q, Li YJ, Wang RR, Sun GB, Pan L, Hu JX, Xie N,
            Zhang C, Tian BC, Jiao F, Xu S, Wang PY and Xie SY.
  TITLE     miR-4293 upregulates lncRNA WFDC21P by suppressing mRNA-decapping
            enzyme 2 to promote lung carcinoma proliferation
  JOURNAL   Cell Death Dis 12 (8), 735 (2021)
   PUBMED   34301920
  REMARK    GeneRIF: miR-4293 upregulates lncRNA WFDC21P by suppressing
            mRNA-decapping enzyme 2 to promote lung carcinoma proliferation.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 78)
  AUTHORS   Ji D, An M and Fang Q.
  TITLE     Whether miR-4293 rs12220909 variant affects cancer susceptibility:
            evidence from 11255 subjects
  JOURNAL   Artif Cells Nanomed Biotechnol 48 (1), 933-938 (2020)
   PUBMED   32496828
  REMARK    GeneRIF: Whether miR-4293 rs12220909 variant affects cancer
            susceptibility: evidence from 11255 subjects.
REFERENCE   4  (bases 1 to 78)
  AUTHORS   Liu R, Fu H, Yu Y, Xu Q, Fang J, Ge Q and Shao Y.
  TITLE     Association of miR-4293 rs12220909 polymorphism with cancer risk: A
            meta-analysis of 8394 subjects
  JOURNAL   Medicine (Baltimore) 99 (32), e21364 (2020)
   PUBMED   32769868
  REMARK    GeneRIF: Association of miR-4293 rs12220909 polymorphism with
            cancer risk: A meta-analysis of 8394 subjects.
REFERENCE   5  (bases 1 to 78)
  AUTHORS   Fan L, Chen L, Ni X, Guo S, Zhou Y, Wang C, Zheng Y, Shen F,
            Kolluri VK, Muktiali M, Zhao Z, Wu J, Zhao D, He Z, Feng X, Yuan Z,
            Zhang J, Jin L, Wang J and Wang M.
  TITLE     Genetic variant of miR-4293 rs12220909 is associated with
            susceptibility to non-small cell lung cancer in a Chinese Han
            population
  JOURNAL   PLoS One 12 (4), e0175666 (2017)
   PUBMED   28410417
  REMARK    GeneRIF: The GC/CC genotypes of miR-4293 rs12220909 were associated
            significantly with decreased non-small cell lung cancer
            susceptibility, which indicates that the mutant allele C of
            rs12220909 can influence the function of miR-4293.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 78)
  AUTHORS   Zhang P, Wang J, Lu T, Wang X, Zheng Y, Guo S, Yang Y, Wang M,
            Kolluri VK, Qiu L, Shen F, Fan L, Li J, Wang Y, Wei Q, Jin L, Wang
            J and Wang M.
  TITLE     miR-449b rs10061133 and miR-4293 rs12220909 polymorphisms are
            associated with decreased esophageal squamous cell carcinoma in a
            Chinese population
  JOURNAL   Tumour Biol 36 (11), 8789-8795 (2015)
   PUBMED   26055141
  REMARK    GeneRIF: This study provides the first evidence that miR-449b
            rs10061133 and miR-4293 rs12220909 are associated with esophageal
            squamous cell carcinoma risk in Chinese population.
REFERENCE   7  (bases 1 to 78)
  AUTHORS   Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and
            Hart RP.
  TITLE     Ago2 immunoprecipitation identifies predicted microRNAs in human
            embryonic stem cells and neural precursors
  JOURNAL   PLoS One 4 (9), e7192 (2009)
   PUBMED   19784364
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 78)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL139405.11.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-78                AL139405.11        43645-43722         c
FEATURES             Location/Qualifiers
     source          1..78
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10p13"
     gene            1..78
                     /gene="MIR4293"
                     /note="microRNA 4293"
                     /db_xref="GeneID:100422843"
                     /db_xref="HGNC:HGNC:38270"
                     /db_xref="miRBase:MI0015826"
     precursor_RNA   1..78
                     /gene="MIR4293"
                     /product="microRNA 4293"
                     /db_xref="GeneID:100422843"
                     /db_xref="HGNC:HGNC:38270"
                     /db_xref="miRBase:MI0015826"
     exon            1..78
                     /gene="MIR4293"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471023807"
     variation       4
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1844035878"
     variation       6
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468712758"
     variation       7
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589341394"
     variation       8
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942693802"
     variation       9
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1589341390"
     variation       10
                     /gene="MIR4293"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1844035772"
     variation       11
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1844035748"
     variation       15
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410759160"
     variation       16
                     /gene="MIR4293"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1844035700"
     variation       18
                     /gene="MIR4293"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:890074736"
     variation       22
                     /gene="MIR4293"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1844035654"
     variation       23
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1844035618"
     variation       26
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2132160301"
     variation       27
                     /gene="MIR4293"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2132160299"
     variation       31
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028133324"
     variation       32
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177886258"
     variation       37
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423723737"
     variation       40
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1844035552"
     variation       47
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764172340"
     variation       48
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1844035512"
     variation       49
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936869670"
     variation       50
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1373538743"
     variation       51
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356710265"
     ncRNA           52..68
                     /ncRNA_class="miRNA"
                     /gene="MIR4293"
                     /product="hsa-miR-4293"
                     /db_xref="miRBase:MIMAT0016848"
                     /db_xref="GeneID:100422843"
                     /db_xref="HGNC:HGNC:38270"
                     /db_xref="miRBase:MI0015826"
     variation       53
                     /gene="MIR4293"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1844035392"
     variation       55
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975745572"
     variation       56
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12220909"
     variation       65
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206375160"
     variation       68
                     /gene="MIR4293"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1589341374"
     variation       70
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1844035217"
     variation       72
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309964913"
     variation       73
                     /gene="MIR4293"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12780876"
     variation       74
                     /gene="MIR4293"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2132160281"
     variation       75
                     /gene="MIR4293"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1589341366"
     variation       76
                     /gene="MIR4293"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1844035063"
ORIGIN      

agagacacctgttccttgggaagctggtgacattgctaattcatttcacaccagcctgacaggaacagcctgactgaa

//