ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-01 10:14:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_036180 81 bp RNA linear PRI 14-NOV-2021
DEFINITION Homo sapiens microRNA 378c (MIR378C), microRNA.
ACCESSION NR_036180
VERSION NR_036180.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 81)
AUTHORS Yu Q, Zheng B, Ji X, Li P and Guo Z.
TITLE miR-378c suppresses Wilms tumor development via negatively
regulating CAMKK2
JOURNAL Acta Biochim Biophys Sin (Shanghai) 53 (6), 739-747 (2021)
PUBMED 33956079
REMARK GeneRIF: miR-378c suppresses Wilms tumor development via negatively
regulating CAMKK2.
REFERENCE 2 (bases 1 to 81)
AUTHORS Tian S, Cao Y, Wang J, Bi Y, Zhong J, Meng X, Sun W, Yang R, Gan L,
Wang X, Li H and Wang R.
TITLE The miR-378c-Samd1 circuit promotes phenotypic modulation of
vascular smooth muscle cells and foam cells formation in
atherosclerosis lesions
JOURNAL Sci Rep 11 (1), 10548 (2021)
PUBMED 34006929
REMARK GeneRIF: The miR-378c-Samd1 circuit promotes phenotypic modulation
of vascular smooth muscle cells and foam cells formation in
atherosclerosis lesions.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 81)
AUTHORS Xia H, Zhang Z, Yuan J and Niu Q.
TITLE The lncRNA PVT1 promotes invasive growth of lung adenocarcinoma
cells by targeting miR-378c to regulate SLC2A1 expression
JOURNAL Hum Cell 34 (1), 201-210 (2021)
PUBMED 32960438
REMARK GeneRIF: The lncRNA PVT1 promotes invasive growth of lung
adenocarcinoma cells by targeting miR-378c to regulate SLC2A1
expression.
REFERENCE 4 (bases 1 to 81)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 81)
AUTHORS Templin C, Volkmann J, Emmert MY, Mocharla P, Muller M, Kraenkel N,
Ghadri JR, Meyer M, Styp-Rekowska B, Briand S, Klingenberg R,
Jaguszewski M, Matter CM, Djonov V, Mach F, Windecker S, Hoerstrup
SP, Thum T, Luscher TF and Landmesser U.
TITLE Increased Proangiogenic Activity of Mobilized CD34+ Progenitor
Cells of Patients With Acute ST-Segment-Elevation Myocardial
Infarction: Role of Differential MicroRNA-378 Expression
JOURNAL Arterioscler Thromb Vasc Biol 37 (2), 341-349 (2017)
PUBMED 28062497
REMARK GeneRIF: miR-378 regulates the angiogenic capacity of CD34(+)
progenitor cells in STEMI patients.
REFERENCE 6 (bases 1 to 81)
AUTHORS Li B, Wang Y, Li S, He H, Sun F, Wang C, Lu Y, Wang X and Tao B.
TITLE Decreased expression of miR-378 correlates with tumor invasiveness
and poor prognosis of patients with glioma
JOURNAL Int J Clin Exp Pathol 8 (6), 7016-7021 (2015)
PUBMED 26261592
REMARK GeneRIF: Results indicate that miR-378 may serve as a tumor
suppressor and play an important role in inhibiting glioma cell
migration and invasion.
Publication Status: Online-Only
REFERENCE 7 (bases 1 to 81)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 8 (bases 1 to 81)
AUTHORS Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and
Hart RP.
TITLE Ago2 immunoprecipitation identifies predicted microRNAs in human
embryonic stem cells and neural precursors
JOURNAL PLoS One 4 (9), e7192 (2009)
PUBMED 19784364
REMARK Publication Status: Online-Only
REFERENCE 9 (bases 1 to 81)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL607076.9.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM611150.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-81 AL607076.9 17482-17562 c
FEATURES Location/Qualifiers
source 1..81
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q26.3"
gene 1..81
/gene="MIR378C"
/gene_synonym="mir-378c"
/note="microRNA 378c"
/db_xref="GeneID:100422867"
/db_xref="HGNC:HGNC:38374"
/db_xref="miRBase:MI0015825"
precursor_RNA 1..81
/gene="MIR378C"
/gene_synonym="mir-378c"
/product="microRNA 378c"
/db_xref="GeneID:100422867"
/db_xref="HGNC:HGNC:38374"
/db_xref="miRBase:MI0015825"
exon 1..81
/gene="MIR378C"
/gene_synonym="mir-378c"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:530160510"
variation 3
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace=""
/replace="a"
/db_xref="dbSNP:1847567065"
variation 3
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1847567039"
variation 5
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203120302"
variation 6
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="c"
/db_xref="dbSNP:1260038309"
variation 7
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1008022556"
variation 9
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="t"
/db_xref="dbSNP:1187408484"
variation 10
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1255712575"
ncRNA 11..35
/ncRNA_class="miRNA"
/gene="MIR378C"
/gene_synonym="mir-378c"
/product="hsa-miR-378c"
/db_xref="miRBase:MIMAT0016847"
/db_xref="GeneID:100422867"
/db_xref="HGNC:HGNC:38374"
/db_xref="miRBase:MI0015825"
variation 14
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1847566924"
variation 15
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/db_xref="dbSNP:954998865"
variation 16
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1476405711"
variation 21
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/db_xref="dbSNP:1187159745"
variation 22
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1847566865"
variation 23
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:936928990"
variation 24
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="t"
/db_xref="dbSNP:924224817"
variation 32
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1031754294"
variation 38
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168308663"
variation 39
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="t"
/db_xref="dbSNP:561292419"
variation 40
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:933449449"
variation 41
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1847566702"
variation 42
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1589744682"
variation 43
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1589744679"
variation 46
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1847566658"
variation 47
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1847566638"
variation 48
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="c"
/db_xref="dbSNP:1847566627"
variation 53
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:904508376"
variation 55
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="t"
/db_xref="dbSNP:1847566579"
variation 59
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311331011"
variation 60
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="t"
/db_xref="dbSNP:1847566553"
variation 64
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:963788455"
variation 67
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/db_xref="dbSNP:1847566507"
variation 69
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="t"
/db_xref="dbSNP:1564762861"
variation 77
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="a"
/replace="g"
/db_xref="dbSNP:1847566479"
variation 81
/gene="MIR378C"
/gene_synonym="mir-378c"
/replace="c"
/replace="g"
/db_xref="dbSNP:1847566464"
ORIGIN
ggaggccatcactggacttggagtcagaagagtggagtcgggtcagacttcaactctgactttgaaggtggtgagtgcctc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]