ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 17:00:39, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031729 80 bp RNA linear PRI 14-FEB-2024
DEFINITION Homo sapiens microRNA 1908 (MIR1908), microRNA.
ACCESSION NR_031729
VERSION NR_031729.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 80)
AUTHORS Zhou,Y. and Li,W.
TITLE Methyltransferase-like 3-mediated m6A modification of miR-1908-5p
contributes to nasopharyngeal carcinoma progression by targeting
homeodomain-only protein homeobox
JOURNAL Environ Toxicol 39 (3), 1631-1640 (2024)
PUBMED 38018881
REMARK GeneRIF: Methyltransferase-like 3-mediated m6A modification of
miR-1908-5p contributes to nasopharyngeal carcinoma progression by
targeting homeodomain-only protein homeobox.
REFERENCE 2 (bases 1 to 80)
AUTHORS Soubeyrand,S., Lau,P., Beehler,K., McShane,K. and McPherson,R.
TITLE miR1908-5p regulates energy homeostasis in hepatocyte models
JOURNAL Sci Rep 11 (1), 23748 (2021)
PUBMED 34887471
REMARK GeneRIF: miR1908-5p regulates energy homeostasis in hepatocyte
models.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 80)
AUTHORS Yoshida,K., Yokoi,A., Matsuzaki,J., Kato,T., Ochiya,T., Kajiyama,H.
and Yamamoto,Y.
TITLE Extracellular microRNA profiling for prognostic prediction in
patients with high-grade serous ovarian carcinoma
JOURNAL Cancer Sci 112 (12), 4977-4986 (2021)
PUBMED 34618992
REMARK GeneRIF: Extracellular microRNA profiling for prognostic prediction
in patients with high-grade serous ovarian carcinoma.
REFERENCE 4 (bases 1 to 80)
AUTHORS Yu,D.S., Song,X.L. and Yan,C.
TITLE Oncogenic miRNA-1908 targets HDAC10 and promotes the aggressive
phenotype of cervical cancer cell
JOURNAL Kaohsiung J Med Sci 37 (5), 402-410 (2021)
PUBMED 33493381
REMARK GeneRIF: Oncogenic miRNA-1908 targets HDAC10 and promotes the
aggressive phenotype of cervical cancer cell.
REFERENCE 5 (bases 1 to 80)
AUTHORS Zhu,Y., Wang,Q., Xia,Y., Xiong,X., Weng,S., Ni,H., Ye,Y., Chen,L.,
Lin,J., Chen,Y., Niu,H., Chen,X. and Lin,Y.
TITLE Evaluation of MiR-1908-3p as a novel serum biomarker for breast
cancer and analysis its oncogenic function and target genes
JOURNAL BMC Cancer 20 (1), 644 (2020)
PUBMED 32650755
REMARK GeneRIF: Evaluation of MiR-1908-3p as a novel serum biomarker for
breast cancer and analysis its oncogenic function and target genes.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 80)
AUTHORS Kozomara,A. and Griffiths-Jones,S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 7 (bases 1 to 80)
AUTHORS Creighton,C.J., Benham,A.L., Zhu,H., Khan,M.F., Reid,J.G.,
Nagaraja,A.K., Fountain,M.D., Dziadek,O., Han,D., Ma,L., Kim,J.,
Hawkins,S.M., Anderson,M.L., Matzuk,M.M. and Gunaratne,P.H.
TITLE Discovery of novel microRNAs in female reproductive tract using
next generation sequencing
JOURNAL PLoS One 5 (3), e9637 (2010)
PUBMED 20224791
REMARK Publication Status: Online-Only
REFERENCE 8 (bases 1 to 80)
AUTHORS Nygaard,S., Jacobsen,A., Lindow,M., Eriksen,J., Balslev,E.,
Flyger,H., Tolstrup,N., Moller,S., Krogh,A. and Litman,T.
TITLE Identification and analysis of miRNAs in human breast cancer and
teratoma samples using deep sequencing
JOURNAL BMC Med Genomics 2, 35 (2009)
PUBMED 19508715
REMARK Publication Status: Online-Only
REFERENCE 9 (bases 1 to 80)
AUTHORS Bar,M., Wyman,S.K., Fritz,B.R., Qi,J., Garg,K.S., Parkin,R.K.,
Kroh,E.M., Bendoraite,A., Mitchell,P.S., Nelson,A.M., Ruzzo,W.L.,
Ware,C., Radich,J.P., Gentleman,R., Ruohola-Baker,H. and Tewari,M.
TITLE MicroRNA discovery and profiling in human embryonic stem cells by
deep sequencing of small RNA libraries
JOURNAL Stem Cells 26 (10), 2496-2505 (2008)
PUBMED 18583537
REFERENCE 10 (bases 1 to 80)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AP002380.3.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM610376.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-80 AP002380.3 136165-136244 c
FEATURES Location/Qualifiers
source 1..80
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.2"
gene 1..80
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/note="microRNA 1908"
/db_xref="GeneID:100302263"
/db_xref="HGNC:HGNC:35392"
/db_xref="miRBase:MI0008329"
precursor_RNA 1..80
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/product="microRNA 1908"
/db_xref="GeneID:100302263"
/db_xref="HGNC:HGNC:35392"
/db_xref="miRBase:MI0008329"
exon 1..80
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:2135942305"
variation 2
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1481697410"
variation 3
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2066969747"
variation 4
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1176536079"
variation 5
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:174561"
variation 6
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2541078986"
variation 7
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454425320"
variation 9
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203639116"
variation 10
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1208260464"
variation 11
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2135942274"
ncRNA 12..32
/ncRNA_class="miRNA"
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/product="hsa-miR-1908-5p"
/db_xref="miRBase:MIMAT0007881"
/db_xref="GeneID:100302263"
/db_xref="HGNC:HGNC:35392"
/db_xref="miRBase:MI0008329"
variation 12
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2066969394"
variation 13
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:2066969350"
variation 14
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2541078970"
variation 15
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042356928"
variation 16..19
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:750758515"
variation 16
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1172531430"
variation 20
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004964674"
variation 24
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2050637164"
variation 26
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:1412162872"
variation 29
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:2066969093"
variation 33
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:546582324"
variation 34
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:915177576"
variation 35..37
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:1372050947"
variation 35
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="t"
/replace="tt"
/db_xref="dbSNP:2066968945"
variation 36
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2066968906"
variation 38
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2066968808"
variation 39
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2066968772"
variation 48
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/db_xref="dbSNP:1591156264"
ncRNA 49..69
/ncRNA_class="miRNA"
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/product="hsa-miR-1908-3p"
/db_xref="miRBase:MIMAT0026916"
/db_xref="GeneID:100302263"
/db_xref="HGNC:HGNC:35392"
/db_xref="miRBase:MI0008329"
variation 50
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2066968688"
variation 51
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2135942218"
variation 54
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:533201588"
variation 55
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301364574"
variation 56
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2066968500"
variation 58..59
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1341507721"
variation 58
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="g"
/db_xref="dbSNP:2066968458"
variation 64
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:564195861"
variation 65..68
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:2541078907"
variation 67
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273704718"
variation 68
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:2066968260"
variation 69
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:878892659"
variation 70
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="g"
/db_xref="dbSNP:1306845828"
variation 71..75
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1274792263"
variation 71
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314769794"
variation 75
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:778143378"
variation 77
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="a"
/replace="c"
/db_xref="dbSNP:2541078891"
variation 79
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2066967976"
variation 80
/gene="MIR1908"
/gene_synonym="hsa-mir-1908; mir-1908; MIRN1908"
/replace="c"
/replace="t"
/db_xref="dbSNP:2066967936"
ORIGIN
cgggaatgccgcggcggggacggcgattggtccgtatgtgtggtgccaccggccgccggctccgccccggcccccgcccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]