2024-05-01 09:34:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031725 72 bp RNA linear PRI 07-JUN-2021 DEFINITION Homo sapiens microRNA 320d-2 (MIR320D2), microRNA. ACCESSION NR_031725 VERSION NR_031725.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 72) AUTHORS Li W, Ding X, Wang S, Xu L, Yin T, Han S, Geng J and Sun W. TITLE Downregulation of serum exosomal miR-320d predicts poor prognosis in hepatocellular carcinoma JOURNAL J Clin Lab Anal 34 (6), e23239 (2020) PUBMED 32125733 REMARK GeneRIF: Downregulation of serum exosomal miR-320d predicts poor prognosis in hepatocellular carcinoma. REFERENCE 2 (bases 1 to 72) AUTHORS Tang Y, Zhao Y, Song X, Song X, Niu L and Xie L. TITLE Tumor-derived exosomal miRNA-320d as a biomarker for metastatic colorectal cancer JOURNAL J Clin Lab Anal 33 (9), e23004 (2019) PUBMED 31420913 REMARK GeneRIF: Serum exosomal miR-320d is a promising non-invasive diagnostic biomarker for distinguishing metastatic from non-metastatic colorectal cancer. REFERENCE 3 (bases 1 to 72) AUTHORS Su H, Chang J, Xu M, Sun R and Wang J. TITLE CDK6 overexpression resulted from microRNA320d downregulation promotes cell proliferation in diffuse large Bcell lymphoma JOURNAL Oncol Rep 42 (1), 321-327 (2019) PUBMED 31059102 REMARK GeneRIF: Study found that overexpression of miR320d inhibits the proliferation of diffuse large Bcell lymphoma (DLBCL) cell lines. In addition, miR320d specifically bound to the CDK6 3'UTR. REFERENCE 4 (bases 1 to 72) AUTHORS Shen H, Lu S, Dong L, Xue Y, Yao C, Tong C, Wang C and Shu X. TITLE hsa-miR-320d and hsa-miR-582, miRNA Biomarkers of Aortic Dissection, Regulate Apoptosis of Vascular Smooth Muscle Cells JOURNAL J Cardiovasc Pharmacol 71 (5), 275-282 (2018) PUBMED 29538087 REMARK GeneRIF: miR-320d and miR-582 were found to be enriched in apoptotic vascular smooth muscle cells of aortic dissection patients. REFERENCE 5 (bases 1 to 72) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 72) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 7 (bases 1 to 72) AUTHORS Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S and Rajewsky N. TITLE Discovering microRNAs from deep sequencing data using miRDeep JOURNAL Nat Biotechnol 26 (4), 407-415 (2008) PUBMED 18392026 REFERENCE 8 (bases 1 to 72) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL451048.13. On Apr 17, 2019 this sequence version replaced NR_031725.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-72 AL451048.13 22063-22134 c FEATURES Location/Qualifiers source 1..72 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="X" /map="Xq27.1" gene 1..72 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /note="microRNA 320d-2" /db_xref="GeneID:100302169" /db_xref="HGNC:HGNC:35388" /db_xref="miRBase:MI0008192" precursor_RNA 1..72 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /product="microRNA 320d-2" /db_xref="GeneID:100302169" /db_xref="HGNC:HGNC:35388" /db_xref="miRBase:MI0008192" exon 1..72 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /inference="alignment:Splign:2.1.0" variation 4 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="g" /db_xref="dbSNP:1405293268" variation 6 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:1446049347" variation 8 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /db_xref="dbSNP:2011450677" variation 10 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:1556097060" variation 12 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:5907732" variation 15 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /db_xref="dbSNP:2011450618" variation 17 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="g" /db_xref="dbSNP:1556097035" variation 18 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="t" /db_xref="dbSNP:782700465" variation 20 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="t" /db_xref="dbSNP:1556097022" variation 23 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:782445617" variation 25 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="t" /db_xref="dbSNP:781832717" variation 33 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:1556097006" variation 39 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:2011450440" variation 41 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:1556096997" ncRNA 42..60 /ncRNA_class="miRNA" /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /product="hsa-miR-320d" /db_xref="miRBase:MIMAT0006764" /db_xref="GeneID:100302169" /db_xref="HGNC:HGNC:35388" /db_xref="miRBase:MI0008192" variation 46..64 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="" /replace="gctgggttgagaggagcag" /db_xref="dbSNP:1602639678" variation 47 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="t" /db_xref="dbSNP:1384057774" variation 48 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="t" /db_xref="dbSNP:1422735584" variation 49 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="g" /db_xref="dbSNP:1330731340" variation 54 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="g" /db_xref="dbSNP:1556096982" variation 58 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:782742486" variation 59 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="c" /replace="g" /db_xref="dbSNP:1441164440" variation 61 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:369352965" variation 62 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1375024579" variation 63 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:781987594" variation 64 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /db_xref="dbSNP:1556096935" variation 68 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="c" /db_xref="dbSNP:782795295" variation 69 /gene="MIR320D2" /gene_synonym="hsa-mir-320d-2; mir-320d-2; MIR320D-2; MIRN320D2" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:782070101" ORIGIN
tatcaataagccttctcttcccagttcttcttggagtcaggaaaagctgggttgagaggagcagaaaagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]