ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-01 19:07:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031724 72 bp RNA linear PRI 19-JUN-2022
DEFINITION Homo sapiens microRNA 320c-2 (MIR320C2), microRNA.
ACCESSION NR_031724
VERSION NR_031724.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 72)
AUTHORS Matamala N, Lara B, Gomez-Mariano G, Martinez S, Vazquez-Dominguez
I, Otero-Sobrino A, Munoz-Callejas A, Sanchez E, Esquinas C,
Bustamante A, Cadenas S, Curi S, Lazaro L, Martinez MT, Rodriguez
E, Miravitlles M, Torres-Duran M, Herrero I, Michel FJ, Castillo S,
Hernandez-Perez JM, Blanco I, Casas F and Martinez-Delgado B.
TITLE miR-320c Regulates SERPINA1 Expression and Is Induced in Patients
With Pulmonary Disease
JOURNAL Arch Bronconeumol 57 (7), 457-463 (2021)
PUBMED 35698951
REMARK GeneRIF: miR-320c Regulates SERPINA1 Expression and Is Induced in
Patients With Pulmonary Disease.
REFERENCE 2 (bases 1 to 72)
AUTHORS Li Y, Huang Y, Zhou C, Jiang PC and Pan W.
TITLE MiR-320c prevents the malignant development of cervical cancer by
regulating GABRP level
JOURNAL Eur Rev Med Pharmacol Sci 24 (17), 8731-8739 (2020)
PUBMED 32964961
REMARK GeneRIF: MiR-320c prevents the malignant development of cervical
cancer by regulating GABRP level.
REFERENCE 3 (bases 1 to 72)
AUTHORS Aripova A, Akparova A and Bersimbaev R.
TITLE The Potential Role of miRNA-19b-3p and miRNA-320c in Patients with
Moderate Bronchial Asthma
JOURNAL Microrna 9 (5), 373-377 (2020)
PUBMED 33632094
REMARK GeneRIF: The Potential Role of miRNA-19b-3p and miRNA-320c in
Patients with Moderate Bronchial Asthma.
REFERENCE 4 (bases 1 to 72)
AUTHORS Sun,H., Huang,Z., Wu,P., Chang,Z., Liao,W. and Zhang,Z.
TITLE CDK6 and miR-320c Co-Regulate Chondrocyte Catabolism Through
NF-kappaB Signaling Pathways
JOURNAL Cell Physiol Biochem 51 (2), 909-923 (2018)
PUBMED 30466085
REMARK GeneRIF: MiR-320c overexpression and CDK6 inhibition attenuated
IL-1beta-induced increases in expression of inflammatory products
such as iNOS and MMP13 and decreased the expression of anabolic
products such as COL2A1 and aggrecan.
REFERENCE 5 (bases 1 to 72)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 72)
AUTHORS Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner
R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu
R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis
E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF and Mayr M.
TITLE Association of MicroRNAs and YRNAs With Platelet Function
JOURNAL Circ Res 118 (3), 420-432 (2016)
PUBMED 26646931
REFERENCE 7 (bases 1 to 72)
AUTHORS Wang X, Wu J, Lin Y, Zhu Y, Xu X, Xu X, Liang Z, Li S, Hu Z, Zheng
X and Xie L.
TITLE MicroRNA-320c inhibits tumorous behaviors of bladder cancer by
targeting Cyclin-dependent kinase 6
JOURNAL J Exp Clin Cancer Res 33, 69 (2014)
PUBMED 25178497
REMARK GeneRIF: miR-320c could inhibit the proliferation, migration and
invasion of bladder cancer cells via regulating CDK6.
Publication Status: Online-Only
REFERENCE 8 (bases 1 to 72)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 9 (bases 1 to 72)
AUTHORS Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R,
Knespel S and Rajewsky N.
TITLE Discovering microRNAs from deep sequencing data using miRDeep
JOURNAL Nat Biotechnol 26 (4), 407-415 (2008)
PUBMED 18392026
REFERENCE 10 (bases 1 to 72)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC023983.11.
On Apr 17, 2019 this sequence version replaced NR_031724.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-72 AC023983.11 86169-86240
FEATURES Location/Qualifiers
source 1..72
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="18"
/map="18q11.2"
gene 1..72
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/note="microRNA 320c-2"
/db_xref="GeneID:100302195"
/db_xref="HGNC:HGNC:35387"
/db_xref="miRBase:MI0008191"
precursor_RNA 1..72
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/product="microRNA 320c-2"
/db_xref="GeneID:100302195"
/db_xref="HGNC:HGNC:35387"
/db_xref="miRBase:MI0008191"
exon 1..72
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:765612087"
variation 3
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="t"
/db_xref="dbSNP:753234427"
variation 8
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="t"
/db_xref="dbSNP:758945141"
variation 9
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276182440"
variation 10
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="g"
/replace="t"
/db_xref="dbSNP:764421548"
variation 11
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1204864848"
variation 12
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2090863117"
variation 22
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:751981145"
variation 24
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1489500700"
variation 26
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:757419162"
variation 29
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268876499"
variation 30
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1433788754"
variation 31
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2090863454"
variation 34
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1201097652"
variation 39
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:781485513"
variation 41
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="g"
/replace="t"
/db_xref="dbSNP:745882220"
ncRNA 42..61
/ncRNA_class="miRNA"
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/product="hsa-miR-320c"
/db_xref="miRBase:MIMAT0005793"
/db_xref="GeneID:100302195"
/db_xref="HGNC:HGNC:35387"
/db_xref="miRBase:MI0008191"
variation 43
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1159517960"
variation 46
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1327994455"
variation 50
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:769415707"
variation 51
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:958657957"
variation 52
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:991776304"
variation 54
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756244906"
variation 58
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285199699"
variation 59
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:780317956"
variation 60
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:748073401"
variation 61
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2090864218"
variation 65
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:917271456"
variation 69
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2090864420"
variation 70
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1324975292"
variation 71
/gene="MIR320C2"
/gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2;
MIRN320C2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1683524154"
ORIGIN
gcatgacaggccttctctttccagttcttcccagaattgggaaaagctgggttgagagggtaagaaaagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]