ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-01 18:11:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031723 72 bp RNA linear PRI 07-JUN-2021
DEFINITION Homo sapiens microRNA 320d-1 (MIR320D1), microRNA.
ACCESSION NR_031723
VERSION NR_031723.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 72)
AUTHORS Li W, Ding X, Wang S, Xu L, Yin T, Han S, Geng J and Sun W.
TITLE Downregulation of serum exosomal miR-320d predicts poor prognosis
in hepatocellular carcinoma
JOURNAL J Clin Lab Anal 34 (6), e23239 (2020)
PUBMED 32125733
REMARK GeneRIF: Downregulation of serum exosomal miR-320d predicts poor
prognosis in hepatocellular carcinoma.
REFERENCE 2 (bases 1 to 72)
AUTHORS Tang Y, Zhao Y, Song X, Song X, Niu L and Xie L.
TITLE Tumor-derived exosomal miRNA-320d as a biomarker for metastatic
colorectal cancer
JOURNAL J Clin Lab Anal 33 (9), e23004 (2019)
PUBMED 31420913
REMARK GeneRIF: Serum exosomal miR-320d is a promising non-invasive
diagnostic biomarker for distinguishing metastatic from
non-metastatic colorectal cancer.
REFERENCE 3 (bases 1 to 72)
AUTHORS Su H, Chang J, Xu M, Sun R and Wang J.
TITLE CDK6 overexpression resulted from microRNA320d downregulation
promotes cell proliferation in diffuse large Bcell lymphoma
JOURNAL Oncol Rep 42 (1), 321-327 (2019)
PUBMED 31059102
REMARK GeneRIF: Study found that overexpression of miR320d inhibits the
proliferation of diffuse large Bcell lymphoma (DLBCL) cell lines.
In addition, miR320d specifically bound to the CDK6 3'UTR.
REFERENCE 4 (bases 1 to 72)
AUTHORS Shen H, Lu S, Dong L, Xue Y, Yao C, Tong C, Wang C and Shu X.
TITLE hsa-miR-320d and hsa-miR-582, miRNA Biomarkers of Aortic
Dissection, Regulate Apoptosis of Vascular Smooth Muscle Cells
JOURNAL J Cardiovasc Pharmacol 71 (5), 275-282 (2018)
PUBMED 29538087
REMARK GeneRIF: miR-320d and miR-582 were found to be enriched in
apoptotic vascular smooth muscle cells of aortic dissection
patients.
REFERENCE 5 (bases 1 to 72)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 72)
AUTHORS Wu PY, Zhang XD, Zhu J, Guo XY and Wang JF.
TITLE Low expression of microRNA-146b-5p and microRNA-320d predicts poor
outcome of large B-cell lymphoma treated with cyclophosphamide,
doxorubicin, vincristine, and prednisone
JOURNAL Hum Pathol 45 (8), 1664-1673 (2014)
PUBMED 24931464
REMARK GeneRIF: these results suggest that low expression of miR-146b-5p
and miR-320d may be predictive of compromised responses of a subset
of diffuse large B-cell lymphoma patients to treatment with the
CHOP regimen
REFERENCE 7 (bases 1 to 72)
AUTHORS Yan Q, Li W, Tang Q, Yao S, Lv Z, Feng N, Ma X, Bai Z, Zeng Y, Qin
D and Lu C.
TITLE Cellular microRNAs 498 and 320d regulate herpes simplex virus 1
induction of Kaposi's sarcoma-associated herpesvirus lytic
replication by targeting RTA
JOURNAL PLoS One 8 (2), e55832 (2013)
PUBMED 23418466
REMARK GeneRIF: host-encoded miR-498 and miR-320d regulated HSV-1
induction of KSHV lytic replication by targeting RTA
REFERENCE 8 (bases 1 to 72)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 9 (bases 1 to 72)
AUTHORS Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R,
Knespel S and Rajewsky N.
TITLE Discovering microRNAs from deep sequencing data using miRDeep
JOURNAL Nat Biotechnol 26 (4), 407-415 (2008)
PUBMED 18392026
REFERENCE 10 (bases 1 to 72)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL355132.19.
On Apr 17, 2019 this sequence version replaced NR_031723.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: ERR279857.3816.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-72 AL355132.19 122492-122563 c
FEATURES Location/Qualifiers
source 1..72
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="13"
/map="13q14.11"
gene 1..72
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/note="microRNA 320d-1"
/db_xref="GeneID:100313896"
/db_xref="HGNC:HGNC:35386"
/db_xref="miRBase:MI0008190"
precursor_RNA 1..72
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/product="microRNA 320d-1"
/db_xref="GeneID:100313896"
/db_xref="HGNC:HGNC:35386"
/db_xref="miRBase:MI0008190"
exon 1..72
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:770024372"
variation 11
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:568406534"
variation 12..16
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1879545741"
variation 12
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:979600991"
variation 17
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:181368210"
variation 18
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760445874"
variation 20
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1879545308"
variation 22
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351855637"
variation 23
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288356741"
variation 24
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1244097298"
variation 27
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358779057"
variation 30
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="g"
/db_xref="dbSNP:748215187"
variation 31
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1879544925"
variation 32
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1454497841"
variation 35
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1383365662"
variation 36
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1238535249"
variation 37
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:74826059"
variation 41
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:778824899"
ncRNA 42..60
/ncRNA_class="miRNA"
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/product="hsa-miR-320d"
/db_xref="miRBase:MIMAT0006764"
/db_xref="GeneID:100313896"
/db_xref="HGNC:HGNC:35386"
/db_xref="miRBase:MI0008190"
variation 42
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:755131134"
variation 43
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1879544438"
variation 44
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1879544374"
variation 46..62
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace=""
/replace="gctgggttgagaggatg"
/db_xref="dbSNP:1371780032"
variation 46
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="g"
/db_xref="dbSNP:535778068"
variation 48
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1879544221"
variation 49..51
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="g"
/replace="ggg"
/db_xref="dbSNP:1212045422"
variation 49
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:569951817"
variation 51
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1879544012"
variation 52
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287962814"
variation 57
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:772990558"
variation 59
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757049836"
variation 60
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013069487"
variation 61
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164999012"
variation 62
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1474057954"
variation 67
/gene="MIR320D1"
/gene_synonym="mir-320d-1; MIR320D-1; MIRN320D1"
/replace="a"
/replace="g"
/db_xref="dbSNP:751415904"
ORIGIN
aaaatgttggccttctcgtcccagttcttcccaaagttgagaaaagctgggttgagaggatgaaaagaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]