2024-05-01 08:04:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031684 51 bp RNA linear PRI 11-SEP-2020 DEFINITION Homo sapiens microRNA 302f (MIR302F), microRNA. ACCESSION NR_031684 VERSION NR_031684.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 51) AUTHORS Kawamura Y, Nakaoka H, Nakayama A, Okada Y, Yamamoto K, Higashino T, Sakiyama M, Shimizu T, Ooyama H, Ooyama K, Nagase M, Hidaka Y, Shirahama Y, Hosomichi K, Nishida Y, Shimoshikiryo I, Hishida A, Katsuura-Kamano S, Shimizu S, Kawaguchi M, Uemura H, Ibusuki R, Hara M, Naito M, Takao M, Nakajima M, Iwasawa S, Nakashima H, Ohnaka K, Nakamura T, Stiburkova B, Merriman TR, Nakatochi M, Ichihara S, Yokota M, Takada T, Saitoh T, Kamatani Y, Takahashi A, Arisawa K, Takezaki T, Tanaka K, Wakai K, Kubo M, Hosoya T, Ichida K, Inoue I, Shinomiya N and Matsuo H. TITLE Genome-wide association study revealed novel loci which aggravate asymptomatic hyperuricaemia into gout JOURNAL Ann. Rheum. Dis. 78 (10), 1430-1437 (2019) PUBMED 31289104 REMARK GeneRIF: The present study revealed three gout specific loci, CNTN5, MIR302F, ZNF724, to be clearly associated with mechanisms of gout development, which distinctly differ from the known gout risk loci that basically elevate serum uric acid level. This meta-analysis is the first to reveal the loci associated with crystal-induced inflammation, the last step in gout development that aggravates asymptomatic hyperuricaemia into gout. REFERENCE 2 (bases 1 to 51) AUTHORS Hagen EM, Sicko RJ, Kay DM, Rigler SL, Dimopoulos A, Ahmad S, Doleman MH, Fan R, Romitti PA, Browne ML, Caggana M, Brody LC, Shaw GM, Jelliffe-Pawlowski LL and Mills JL. TITLE Copy-number variant analysis of classic heterotaxy highlights the importance of body patterning pathways JOURNAL Hum. Genet. 135 (12), 1355-1364 (2016) PUBMED 27637763 REMARK GeneRIF: FGF12, RBFOX1, and MIR302F could be important in human heterotaxy, because they were noted in multiple cases. Further investigation into genes involved in the NODAL, BMP, and WNT body patterning pathways and into the dosage effects of FGF12, RBFOX1, and MIR302F is warranted. REFERENCE 3 (bases 1 to 51) AUTHORS Li Q, Wojciechowski R, Simpson CL, Hysi PG, Verhoeven VJ, Ikram MK, Hohn R, Vitart V, Hewitt AW, Oexle K, Makela KM, MacGregor S, Pirastu M, Fan Q, Cheng CY, St Pourcain B, McMahon G, Kemp JP, Northstone K, Rahi JS, Cumberland PM, Martin NG, Sanfilippo PG, Lu Y, Wang YX, Hayward C, Polasek O, Campbell H, Bencic G, Wright AF, Wedenoja J, Zeller T, Schillert A, Mirshahi A, Lackner K, Yip SP, Yap MK, Ried JS, Gieger C, Murgia F, Wilson JF, Fleck B, Yazar S, Vingerling JR, Hofman A, Uitterlinden A, Rivadeneira F, Amin N, Karssen L, Oostra BA, Zhou X, Teo YY, Tai ES, Vithana E, Barathi V, Zheng Y, Siantar RG, Neelam K, Shin Y, Lam J, Yonova-Doing E, Venturini C, Hosseini SM, Wong HS, Lehtimaki T, Kahonen M, Raitakari O, Timpson NJ, Evans DM, Khor CC, Aung T, Young TL, Mitchell P, Klein B, van Duijn CM, Meitinger T, Jonas JB, Baird PN, Mackey DA, Wong TY, Saw SM, Parssinen O, Stambolian D, Hammond CJ, Klaver CC, Williams C, Paterson AD, Bailey-Wilson JE and Guggenheim JA. CONSRTM CREAM Consortium TITLE Genome-wide association study for refractive astigmatism reveals genetic co-determination with spherical equivalent refractive error: the CREAM consortium JOURNAL Hum. Genet. 134 (2), 131-146 (2015) PUBMED 25367360 REFERENCE 4 (bases 1 to 51) AUTHORS Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ and Marra MA. TITLE Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells JOURNAL Genome Res. 18 (4), 610-621 (2008) PUBMED 18285502 REMARK Erratum:[Genome Res. 2009 May;19(5):958] REFERENCE 5 (bases 1 to 51) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC115100.3. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-51 AC115100.3 82213-82263 FEATURES Location/Qualifiers source 1..51 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="18" /map="18q12.1" gene 1..51 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /note="microRNA 302f" /db_xref="GeneID:100302131" /db_xref="HGNC:HGNC:35349" /db_xref="miRBase:MI0006418" precursor_RNA 1..51 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /product="microRNA 302f" /db_xref="GeneID:100302131" /db_xref="HGNC:HGNC:35349" /db_xref="miRBase:MI0006418" exon 1..51 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /inference="alignment:Splign:2.1.0" variation 4 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:1286487309" variation 7 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:1325002616" variation 9 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:1359903313" variation 16 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="c" /db_xref="dbSNP:1295353976" variation 17 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:1383169566" variation 19 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:1914308837" variation 20 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:1914308866" variation 23 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:868685692" variation 24 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1214098852" variation 25 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="c" /db_xref="dbSNP:1342914676" ncRNA 27..43 /ncRNA_class="miRNA" /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /product="hsa-miR-302f" /db_xref="miRBase:MIMAT0005932" /db_xref="GeneID:100302131" /db_xref="HGNC:HGNC:35349" /db_xref="miRBase:MI0006418" variation 29 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="c" /db_xref="dbSNP:1914309004" variation 33 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="g" /db_xref="dbSNP:778021887" variation 36 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:1914309080" variation 37 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:543657312" variation 38 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:749435098" variation 39 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:943904582" variation 40 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="" /replace="g" /db_xref="dbSNP:1914309232" variation 40 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:1914309207" variation 41..43 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="tt" /replace="ttt" /db_xref="dbSNP:1202017870" variation 43 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="c" /replace="t" /db_xref="dbSNP:777136689" variation 46 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:759770332" variation 49 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:770158789" variation 51 /gene="MIR302F" /gene_synonym="hsa-mir-302f; MIRN302F" /replace="a" /replace="g" /db_xref="dbSNP:775405313" ORIGIN
tctgtgtaaacctggcaattttcacttaattgcttccatgtttataaaaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]