LOCUS       NR_031684                 51 bp    RNA     linear   PRI 11-SEP-2020
DEFINITION  Homo sapiens microRNA 302f (MIR302F), microRNA.
ACCESSION   NR_031684
VERSION     NR_031684.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 51)
  AUTHORS   Kawamura Y, Nakaoka H, Nakayama A, Okada Y, Yamamoto K, Higashino
            T, Sakiyama M, Shimizu T, Ooyama H, Ooyama K, Nagase M, Hidaka Y,
            Shirahama Y, Hosomichi K, Nishida Y, Shimoshikiryo I, Hishida A,
            Katsuura-Kamano S, Shimizu S, Kawaguchi M, Uemura H, Ibusuki R,
            Hara M, Naito M, Takao M, Nakajima M, Iwasawa S, Nakashima H,
            Ohnaka K, Nakamura T, Stiburkova B, Merriman TR, Nakatochi M,
            Ichihara S, Yokota M, Takada T, Saitoh T, Kamatani Y, Takahashi A,
            Arisawa K, Takezaki T, Tanaka K, Wakai K, Kubo M, Hosoya T, Ichida
            K, Inoue I, Shinomiya N and Matsuo H.
  TITLE     Genome-wide association study revealed novel loci which aggravate
            asymptomatic hyperuricaemia into gout
  JOURNAL   Ann. Rheum. Dis. 78 (10), 1430-1437 (2019)
   PUBMED   31289104
  REMARK    GeneRIF: The present study revealed three gout specific loci,
            CNTN5, MIR302F, ZNF724, to be clearly associated with mechanisms of
            gout development, which distinctly differ from the known gout risk
            loci that basically elevate serum uric acid level. This
            meta-analysis is the first to reveal the loci associated with
            crystal-induced inflammation, the last step in gout development
            that aggravates asymptomatic hyperuricaemia into gout.
REFERENCE   2  (bases 1 to 51)
  AUTHORS   Hagen EM, Sicko RJ, Kay DM, Rigler SL, Dimopoulos A, Ahmad S,
            Doleman MH, Fan R, Romitti PA, Browne ML, Caggana M, Brody LC, Shaw
            GM, Jelliffe-Pawlowski LL and Mills JL.
  TITLE     Copy-number variant analysis of classic heterotaxy highlights the
            importance of body patterning pathways
  JOURNAL   Hum. Genet. 135 (12), 1355-1364 (2016)
   PUBMED   27637763
  REMARK    GeneRIF: FGF12, RBFOX1, and MIR302F could be important in human
            heterotaxy, because they were noted in multiple cases. Further
            investigation into genes involved in the NODAL, BMP, and WNT body
            patterning pathways and into the dosage effects of FGF12, RBFOX1,
            and MIR302F is warranted.
REFERENCE   3  (bases 1 to 51)
  AUTHORS   Li Q, Wojciechowski R, Simpson CL, Hysi PG, Verhoeven VJ, Ikram MK,
            Hohn R, Vitart V, Hewitt AW, Oexle K, Makela KM, MacGregor S,
            Pirastu M, Fan Q, Cheng CY, St Pourcain B, McMahon G, Kemp JP,
            Northstone K, Rahi JS, Cumberland PM, Martin NG, Sanfilippo PG, Lu
            Y, Wang YX, Hayward C, Polasek O, Campbell H, Bencic G, Wright AF,
            Wedenoja J, Zeller T, Schillert A, Mirshahi A, Lackner K, Yip SP,
            Yap MK, Ried JS, Gieger C, Murgia F, Wilson JF, Fleck B, Yazar S,
            Vingerling JR, Hofman A, Uitterlinden A, Rivadeneira F, Amin N,
            Karssen L, Oostra BA, Zhou X, Teo YY, Tai ES, Vithana E, Barathi V,
            Zheng Y, Siantar RG, Neelam K, Shin Y, Lam J, Yonova-Doing E,
            Venturini C, Hosseini SM, Wong HS, Lehtimaki T, Kahonen M,
            Raitakari O, Timpson NJ, Evans DM, Khor CC, Aung T, Young TL,
            Mitchell P, Klein B, van Duijn CM, Meitinger T, Jonas JB, Baird PN,
            Mackey DA, Wong TY, Saw SM, Parssinen O, Stambolian D, Hammond CJ,
            Klaver CC, Williams C, Paterson AD, Bailey-Wilson JE and Guggenheim
            JA.
  CONSRTM   CREAM Consortium
  TITLE     Genome-wide association study for refractive astigmatism reveals
            genetic co-determination with spherical equivalent refractive
            error: the CREAM consortium
  JOURNAL   Hum. Genet. 134 (2), 131-146 (2015)
   PUBMED   25367360
REFERENCE   4  (bases 1 to 51)
  AUTHORS   Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu
            AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ and Marra MA.
  TITLE     Application of massively parallel sequencing to microRNA profiling
            and discovery in human embryonic stem cells
  JOURNAL   Genome Res. 18 (4), 610-621 (2008)
   PUBMED   18285502
  REMARK    Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE   5  (bases 1 to 51)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC115100.3.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-51                AC115100.3         82213-82263
FEATURES             Location/Qualifiers
     source          1..51
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q12.1"
     gene            1..51
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /note="microRNA 302f"
                     /db_xref="GeneID:100302131"
                     /db_xref="HGNC:HGNC:35349"
                     /db_xref="miRBase:MI0006418"
     precursor_RNA   1..51
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /product="microRNA 302f"
                     /db_xref="GeneID:100302131"
                     /db_xref="HGNC:HGNC:35349"
                     /db_xref="miRBase:MI0006418"
     exon            1..51
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286487309"
     variation       7
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325002616"
     variation       9
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359903313"
     variation       16
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1295353976"
     variation       17
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383169566"
     variation       19
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1914308837"
     variation       20
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1914308866"
     variation       23
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868685692"
     variation       24
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1214098852"
     variation       25
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342914676"
     ncRNA           27..43
                     /ncRNA_class="miRNA"
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /product="hsa-miR-302f"
                     /db_xref="miRBase:MIMAT0005932"
                     /db_xref="GeneID:100302131"
                     /db_xref="HGNC:HGNC:35349"
                     /db_xref="miRBase:MI0006418"
     variation       29
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1914309004"
     variation       33
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778021887"
     variation       36
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1914309080"
     variation       37
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543657312"
     variation       38
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749435098"
     variation       39
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943904582"
     variation       40
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1914309232"
     variation       40
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1914309207"
     variation       41..43
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1202017870"
     variation       43
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777136689"
     variation       46
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759770332"
     variation       49
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770158789"
     variation       51
                     /gene="MIR302F"
                     /gene_synonym="hsa-mir-302f; MIRN302F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775405313"
ORIGIN      

tctgtgtaaacctggcaattttcacttaattgcttccatgtttataaaaga

//