GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 17:00:38, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031681                 80 bp    RNA     linear   PRI 08-APR-2023
DEFINITION  Homo sapiens microRNA 1275 (MIR1275), microRNA.
ACCESSION   NR_031681
VERSION     NR_031681.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 80)
  AUTHORS   Liu H, Zhao H, Huang Y and Lei M.
  TITLE     Circ_0002715 promotes the development of osteoarthritis through
            regulating LXN by sponging miR-127-5p
  JOURNAL   J Orthop Surg Res 18 (1), 230 (2023)
   PUBMED   36949500
  REMARK    GeneRIF: Circ_0002715 promotes the development of osteoarthritis
            through regulating LXN by sponging miR-127-5p.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 80)
  AUTHORS   Han X, Li M, Xu J, Fu J, Wang X, Wang J, Xia T, Wang S and Ma G.
  TITLE     miR-1275 targets MDK/AKT signaling to inhibit breast cancer
            chemoresistance by lessening the properties of cancer stem cells
  JOURNAL   Int J Biol Sci 19 (1), 89-103 (2023)
   PUBMED   36594100
  REMARK    GeneRIF: miR-1275 targets MDK/AKT signaling to inhibit breast
            cancer chemoresistance by lessening the properties of cancer stem
            cells.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 80)
  AUTHORS   Lin C, He X, Chen X, Liu L, Guan H, Xiao H and Li Y.
  TITLE     miR-1275 Inhibits Human Omental Adipose-Derived Stem Cells
            Differentiation Toward the Beige Phenotype via PRDM16
  JOURNAL   Stem Cells Dev 31 (23-24), 799-809 (2022)
   PUBMED   36128801
  REMARK    GeneRIF: miR-1275 Inhibits Human Omental Adipose-Derived Stem Cells
            Differentiation Toward the Beige Phenotype via PRDM16.
REFERENCE   4  (bases 1 to 80)
  AUTHORS   Tong QH, Hu HY, Chai H, Wu AB, Guo XH, Wang S, Zhang YF and Fan XY.
  TITLE     Dysregulation of the miR-1275/HK2 Axis Contributes to the
            Progression of Hypoxia/Reoxygenation-Induced Myocardial Injury
  JOURNAL   Arch Med Res 52 (5), 461-470 (2021)
   PUBMED   33551225
  REMARK    GeneRIF: Dysregulation of the miR-1275/HK2 Axis Contributes to the
            Progression of Hypoxia/Reoxygenation-Induced Myocardial Injury.
REFERENCE   5  (bases 1 to 80)
  AUTHORS   Majed SO and Mustafa SA.
  TITLE     MACE-Seq-based coding RNA and TrueQuant-based small RNA profile in
            breast cancer: tumor-suppressive miRNA-1275 identified as a novel
            marker
  JOURNAL   BMC Cancer 21 (1), 473 (2021)
   PUBMED   33910530
  REMARK    GeneRIF: MACE-Seq-based coding RNA and TrueQuant-based small RNA
            profile in breast cancer: tumor-suppressive miRNA-1275 identified
            as a novel marker.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 80)
  AUTHORS   Kamboh MI, Barmada MM, Demirci FY, Minster RL, Carrasquillo MM,
            Pankratz VS, Younkin SG, Saykin AJ, Sweet RA, Feingold E, DeKosky
            ST and Lopez OL.
  CONSRTM   Alzheimer's Disease Neuroimaging Initiative
  TITLE     Genome-wide association analysis of age-at-onset in Alzheimer's
            disease
  JOURNAL   Mol Psychiatry 17 (12), 1340-1346 (2012)
   PUBMED   22005931
REFERENCE   7  (bases 1 to 80)
  AUTHORS   Katsushima K, Shinjo K, Natsume A, Ohka F, Fujii M, Osada H, Sekido
            Y and Kondo Y.
  TITLE     Contribution of microRNA-1275 to Claudin11 protein suppression via
            a polycomb-mediated silencing mechanism in human glioma stem-like
            cells
  JOURNAL   J Biol Chem 287 (33), 27396-27406 (2012)
   PUBMED   22736761
  REMARK    GeneRIF: Treatment with 3-deazaneplanocin A, an inhibitor of H3K27
            methyltransferase, attenuated CLDN11 induction by serum stimulation
            in parallel with sustained miR-1275 expression
REFERENCE   8  (bases 1 to 80)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   9  (bases 1 to 80)
  AUTHORS   Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu
            AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ and Marra MA.
  TITLE     Application of massively parallel sequencing to microRNA profiling
            and discovery in human embryonic stem cells
  JOURNAL   Genome Res 18 (4), 610-621 (2008)
   PUBMED   18285502
  REMARK    Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE   10 (bases 1 to 80)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL589941.6.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM610165.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-80                AL589941.6         62682-62761         c
FEATURES             Location/Qualifiers
     source          1..80
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6p21.31"
     gene            1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /note="microRNA 1275"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     precursor_RNA   1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /product="microRNA 1275"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     exon            1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2127426420"
     variation       6
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774838585"
     variation       8
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581561082"
     variation       9
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1763474227"
     variation       10
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769309157"
     variation       12
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2533590075"
     variation       15
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561621521"
     variation       16
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406639396"
     ncRNA           18..34
                     /ncRNA_class="miRNA"
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /product="hsa-miR-1275"
                     /db_xref="miRBase:MIMAT0005929"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     variation       18
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1763474124"
     variation       19
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772691699"
     variation       20
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374728385"
     variation       22
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1763474024"
     variation       23
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370361021"
     variation       24
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747378297"
     variation       29
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377188203"
     variation       30
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758811783"
     variation       32..34
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace=""
                     /replace="gtc"
                     /db_xref="dbSNP:761034364"
     variation       32..33
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace=""
                     /replace="ggttt"
                     /db_xref="dbSNP:372458638"
     variation       33
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557928121"
     variation       36
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1763473839"
     variation       39
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2533590035"
     variation       41
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419247089"
     variation       42
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76156362"
     variation       43
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157432039"
     variation       46
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367662685"
     variation       49
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916437040"
     variation       51
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2533590023"
     variation       55
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270203211"
     variation       57
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369650791"
     variation       60
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755014949"
     variation       62
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461660813"
     variation       67
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1763473599"
     variation       71
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754069425"
     variation       75
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2533590009"
     variation       77
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766570541"
     variation       80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761663332"
ORIGIN      
cctctgtgagaaagggtgtgggggagaggctgtcttgtgtctgtaagtatgccaaacttattttccccaaggcagaggga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]