ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 17:00:38, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031681 80 bp RNA linear PRI 08-APR-2023
DEFINITION Homo sapiens microRNA 1275 (MIR1275), microRNA.
ACCESSION NR_031681
VERSION NR_031681.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 80)
AUTHORS Liu H, Zhao H, Huang Y and Lei M.
TITLE Circ_0002715 promotes the development of osteoarthritis through
regulating LXN by sponging miR-127-5p
JOURNAL J Orthop Surg Res 18 (1), 230 (2023)
PUBMED 36949500
REMARK GeneRIF: Circ_0002715 promotes the development of osteoarthritis
through regulating LXN by sponging miR-127-5p.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 80)
AUTHORS Han X, Li M, Xu J, Fu J, Wang X, Wang J, Xia T, Wang S and Ma G.
TITLE miR-1275 targets MDK/AKT signaling to inhibit breast cancer
chemoresistance by lessening the properties of cancer stem cells
JOURNAL Int J Biol Sci 19 (1), 89-103 (2023)
PUBMED 36594100
REMARK GeneRIF: miR-1275 targets MDK/AKT signaling to inhibit breast
cancer chemoresistance by lessening the properties of cancer stem
cells.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 80)
AUTHORS Lin C, He X, Chen X, Liu L, Guan H, Xiao H and Li Y.
TITLE miR-1275 Inhibits Human Omental Adipose-Derived Stem Cells
Differentiation Toward the Beige Phenotype via PRDM16
JOURNAL Stem Cells Dev 31 (23-24), 799-809 (2022)
PUBMED 36128801
REMARK GeneRIF: miR-1275 Inhibits Human Omental Adipose-Derived Stem Cells
Differentiation Toward the Beige Phenotype via PRDM16.
REFERENCE 4 (bases 1 to 80)
AUTHORS Tong QH, Hu HY, Chai H, Wu AB, Guo XH, Wang S, Zhang YF and Fan XY.
TITLE Dysregulation of the miR-1275/HK2 Axis Contributes to the
Progression of Hypoxia/Reoxygenation-Induced Myocardial Injury
JOURNAL Arch Med Res 52 (5), 461-470 (2021)
PUBMED 33551225
REMARK GeneRIF: Dysregulation of the miR-1275/HK2 Axis Contributes to the
Progression of Hypoxia/Reoxygenation-Induced Myocardial Injury.
REFERENCE 5 (bases 1 to 80)
AUTHORS Majed SO and Mustafa SA.
TITLE MACE-Seq-based coding RNA and TrueQuant-based small RNA profile in
breast cancer: tumor-suppressive miRNA-1275 identified as a novel
marker
JOURNAL BMC Cancer 21 (1), 473 (2021)
PUBMED 33910530
REMARK GeneRIF: MACE-Seq-based coding RNA and TrueQuant-based small RNA
profile in breast cancer: tumor-suppressive miRNA-1275 identified
as a novel marker.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 80)
AUTHORS Kamboh MI, Barmada MM, Demirci FY, Minster RL, Carrasquillo MM,
Pankratz VS, Younkin SG, Saykin AJ, Sweet RA, Feingold E, DeKosky
ST and Lopez OL.
CONSRTM Alzheimer's Disease Neuroimaging Initiative
TITLE Genome-wide association analysis of age-at-onset in Alzheimer's
disease
JOURNAL Mol Psychiatry 17 (12), 1340-1346 (2012)
PUBMED 22005931
REFERENCE 7 (bases 1 to 80)
AUTHORS Katsushima K, Shinjo K, Natsume A, Ohka F, Fujii M, Osada H, Sekido
Y and Kondo Y.
TITLE Contribution of microRNA-1275 to Claudin11 protein suppression via
a polycomb-mediated silencing mechanism in human glioma stem-like
cells
JOURNAL J Biol Chem 287 (33), 27396-27406 (2012)
PUBMED 22736761
REMARK GeneRIF: Treatment with 3-deazaneplanocin A, an inhibitor of H3K27
methyltransferase, attenuated CLDN11 induction by serum stimulation
in parallel with sustained miR-1275 expression
REFERENCE 8 (bases 1 to 80)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 9 (bases 1 to 80)
AUTHORS Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu
AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ and Marra MA.
TITLE Application of massively parallel sequencing to microRNA profiling
and discovery in human embryonic stem cells
JOURNAL Genome Res 18 (4), 610-621 (2008)
PUBMED 18285502
REMARK Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE 10 (bases 1 to 80)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL589941.6.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM610165.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-80 AL589941.6 62682-62761 c
FEATURES Location/Qualifiers
source 1..80
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6p21.31"
gene 1..80
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/note="microRNA 1275"
/db_xref="GeneID:100302123"
/db_xref="HGNC:HGNC:35346"
/db_xref="miRBase:MI0006415"
precursor_RNA 1..80
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/product="microRNA 1275"
/db_xref="GeneID:100302123"
/db_xref="HGNC:HGNC:35346"
/db_xref="miRBase:MI0006415"
exon 1..80
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/inference="alignment:Splign:2.1.0"
variation 2
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="t"
/db_xref="dbSNP:2127426420"
variation 6
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:774838585"
variation 8
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581561082"
variation 9
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="c"
/db_xref="dbSNP:1763474227"
variation 10
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="g"
/replace="t"
/db_xref="dbSNP:769309157"
variation 12
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2533590075"
variation 15
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="g"
/db_xref="dbSNP:561621521"
variation 16
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406639396"
ncRNA 18..34
/ncRNA_class="miRNA"
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/product="hsa-miR-1275"
/db_xref="miRBase:MIMAT0005929"
/db_xref="GeneID:100302123"
/db_xref="HGNC:HGNC:35346"
/db_xref="miRBase:MI0006415"
variation 18
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="g"
/replace="t"
/db_xref="dbSNP:1763474124"
variation 19
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="t"
/db_xref="dbSNP:772691699"
variation 20
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:374728385"
variation 22
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:1763474024"
variation 23
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:370361021"
variation 24
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:747378297"
variation 29
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:377188203"
variation 30
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="t"
/db_xref="dbSNP:758811783"
variation 32..34
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace=""
/replace="gtc"
/db_xref="dbSNP:761034364"
variation 32..33
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace=""
/replace="ggttt"
/db_xref="dbSNP:372458638"
variation 33
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="t"
/db_xref="dbSNP:557928121"
variation 36
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="g"
/replace="t"
/db_xref="dbSNP:1763473839"
variation 39
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:2533590035"
variation 41
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="g"
/db_xref="dbSNP:1419247089"
variation 42
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="t"
/db_xref="dbSNP:76156362"
variation 43
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1157432039"
variation 46
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="t"
/db_xref="dbSNP:367662685"
variation 49
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:916437040"
variation 51
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:2533590023"
variation 55
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:1270203211"
variation 57
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:369650791"
variation 60
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:755014949"
variation 62
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="t"
/db_xref="dbSNP:1461660813"
variation 67
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="c"
/replace="t"
/db_xref="dbSNP:1763473599"
variation 71
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:754069425"
variation 75
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:2533590009"
variation 77
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="g"
/db_xref="dbSNP:766570541"
variation 80
/gene="MIR1275"
/gene_synonym="hsa-mir-1275; mir-1275; MIRN1275"
/replace="a"
/replace="t"
/db_xref="dbSNP:761663332"
ORIGIN
cctctgtgagaaagggtgtgggggagaggctgtcttgtgtctgtaagtatgccaaacttattttccccaaggcagaggga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]