ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-01 12:14:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031607 85 bp RNA linear PRI 15-FEB-2021
DEFINITION Homo sapiens microRNA 1203 (MIR1203), microRNA.
ACCESSION NR_031607
VERSION NR_031607.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 85)
AUTHORS Luo T, Yan L and Liu H.
TITLE LINC00632 inhibits the malignant development of non-small cell lung
cancer by downregulating miR-1203
JOURNAL J BUON 25 (3), 1517-1524 (2020)
PUBMED 32862599
REMARK GeneRIF: LINC00632 inhibits the malignant development of non-small
cell lung cancer by downregulating miR-1203.
REFERENCE 2 (bases 1 to 85)
AUTHORS Shi J, Li X, Hu Y, Zhang F, Lv X, Zhang X, Chen Q and Hu S.
TITLE MiR-1203 is involved in hepatocellular carcinoma metastases and
indicates a poor prognosis
JOURNAL Neoplasma 67 (2), 267-276 (2020)
PUBMED 31847527
REMARK GeneRIF: MiR-1203 is involved in hepatocellular carcinoma
metastases and indicates a poor prognosis.
REFERENCE 3 (bases 1 to 85)
AUTHORS Xu HB, Zheng YF, Wu D, Li Y, Zhou LN and Chen YG.
TITLE microRNA-1203 targets and silences cyclophilin D to protect human
endometrial cells from oxygen and glucose
deprivation-re-oxygenation
JOURNAL Aging (Albany NY) 12 (3), 3010-3024 (2020)
PUBMED 32041924
REMARK GeneRIF: microRNA-1203 targets and silences cyclophilin D to
protect human endometrial cells from oxygen and glucose
deprivation-re-oxygenation.
REFERENCE 4 (bases 1 to 85)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 85)
AUTHORS Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch
O, Rovira C, Naya H, Dighiero G and Cayota A.
TITLE Small RNAs analysis in CLL reveals a deregulation of miRNA
expression and novel miRNA candidates of putative relevance in CLL
pathogenesis
JOURNAL Leukemia 22 (2), 330-338 (2008)
PUBMED 17989717
REFERENCE 6 (bases 1 to 85)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC006468.10.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-85 AC006468.10 24703-24787
FEATURES Location/Qualifiers
source 1..85
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q21.32"
gene 1..85
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/note="microRNA 1203"
/db_xref="GeneID:100302211"
/db_xref="HGNC:HGNC:35269"
/db_xref="miRBase:MI0006335"
precursor_RNA 1..85
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/product="microRNA 1203"
/db_xref="GeneID:100302211"
/db_xref="HGNC:HGNC:35269"
/db_xref="miRBase:MI0006335"
exon 1..85
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598375873"
variation 2
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1212885775"
variation 3
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/db_xref="dbSNP:924393341"
variation 4
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598375862"
variation 5
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1364121351"
ncRNA 6..26
/ncRNA_class="miRNA"
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/product="hsa-miR-1203"
/db_xref="miRBase:MIMAT0005866"
/db_xref="GeneID:100302211"
/db_xref="HGNC:HGNC:35269"
/db_xref="miRBase:MI0006335"
variation 8
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:547972348"
variation 9..10
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="g"
/replace="gg"
/db_xref="dbSNP:745577400"
variation 9
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:764824939"
variation 10
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:2063979583"
variation 11
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/db_xref="dbSNP:2143212940"
variation 12
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:995110609"
variation 17
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1231461203"
variation 18
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1338531929"
variation 20
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439248445"
variation 23
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:759274065"
variation 26
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399107302"
variation 29
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397225938"
variation 31
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/db_xref="dbSNP:370132472"
variation 32
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:971148331"
variation 33
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/db_xref="dbSNP:770750211"
variation 34
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/db_xref="dbSNP:2143212576"
variation 36
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/db_xref="dbSNP:760600373"
variation 37
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:2143212502"
variation 38
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:2063978984"
variation 39
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:773079400"
variation 41
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:772132659"
variation 43
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185828122"
variation 46
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461993785"
variation 48
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:377012273"
variation 49
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:779157281"
variation 50
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598375745"
variation 52
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:769023712"
variation 55
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273851060"
variation 56
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="t"
/db_xref="dbSNP:1567796918"
variation 59
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:749572635"
variation 65
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:780536735"
variation 68
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:117091718"
variation 69
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="g"
/replace="t"
/db_xref="dbSNP:2063978303"
variation 74
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:750931820"
variation 75
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:781566509"
variation 76
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296220394"
variation 78
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/db_xref="dbSNP:757861784"
variation 79
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:373807500"
variation 80
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598375672"
variation 81
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="g"
/db_xref="dbSNP:1332949319"
variation 82
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="c"
/replace="t"
/db_xref="dbSNP:752166614"
variation 83
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="a"
/replace="g"
/db_xref="dbSNP:368862137"
variation 84
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="g"
/replace="t"
/db_xref="dbSNP:764848039"
variation 85
/gene="MIR1203"
/gene_synonym="hsa-mir-1203; MIRN1203"
/replace="g"
/replace="t"
/db_xref="dbSNP:1383931148"
ORIGIN
tcctccccggagccaggatgcagctcaagccacagcagggtgtttagcgctcttcagtggctccagattgtggcgctggtgcagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]