LOCUS       NR_030626                 56 bp    RNA     linear   PRI 03-SEP-2020
DEFINITION  Homo sapiens microRNA 921 (MIR921), microRNA.
ACCESSION   NR_030626
VERSION     NR_030626.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 56)
  AUTHORS   Choi JY, An BC, Jung IJ, Kim JH and Lee SW.
  TITLE     MiR-921 directly downregulates GPx3 in A549 lung cancer cells
  JOURNAL   Gene 700, 163-167 (2019)
   PUBMED   30898707
  REMARK    GeneRIF: Study found that miR-921 expression is downregulated in
            A549 lung cancer cells. Further data demonstrate that miR-921
            directly inhibits GPx3 expression in A549 lung cancer cells.
REFERENCE   2  (bases 1 to 56)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 56)
  AUTHORS   Kalabus JL, Cheng Q and Blanco JG.
  TITLE     MicroRNAs differentially regulate carbonyl reductase 1 (CBR1) gene
            expression dependent on the allele status of the common polymorphic
            variant rs9024
  JOURNAL   PLoS ONE 7 (11), e48622 (2012)
   PUBMED   23133646
  REMARK    GeneRIF: regulation of human CBR1 expression by hsa-miR-574-5p and
            hsa-miR-921 depends upon rs9024 genotype status
REFERENCE   4  (bases 1 to 56)
  AUTHORS   Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E
            and Leffers H.
  TITLE     Analysis of gene expression in normal and neoplastic human testis:
            new roles of RNA
  JOURNAL   Int. J. Androl. 30 (4), 316-26 (2007)
   PUBMED   17573847
REFERENCE   5  (bases 1 to 56)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL596087.11.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-56                AL596087.11        34738-34793         c
FEATURES             Location/Qualifiers
     source          1..56
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q24.1"
     gene            1..56
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /note="microRNA 921"
                     /db_xref="GeneID:100126349"
                     /db_xref="HGNC:HGNC:33671"
                     /db_xref="miRBase:MI0005713"
     precursor_RNA   1..56
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /product="microRNA 921"
                     /db_xref="GeneID:100126349"
                     /db_xref="HGNC:HGNC:33671"
                     /db_xref="miRBase:MI0005713"
     exon            1..56
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927382951"
     ncRNA           2..26
                     /ncRNA_class="miRNA"
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /product="hsa-miR-921"
                     /db_xref="miRBase:MIMAT0004971"
                     /db_xref="GeneID:100126349"
                     /db_xref="HGNC:HGNC:33671"
                     /db_xref="miRBase:MI0005713"
     variation       4
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464259216"
     variation       6
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1655831278"
     variation       9
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768428855"
     variation       21
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746970999"
     variation       24
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2101801252"
     variation       29
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2101801248"
     variation       30
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438535041"
     variation       32
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956176621"
     variation       36
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775467908"
     variation       39
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745911319"
     variation       40
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779291725"
     variation       41
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199038899"
     variation       43
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353122810"
     variation       45
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1655829715"
     variation       46
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757486025"
     variation       50
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:373754478"
     variation       50
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239605888"
     variation       51
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748921038"
     variation       52
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749515564"
     variation       54
                     /gene="MIR921"
                     /gene_synonym="hsa-mir-921; MIRN921"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307059775"
ORIGIN      

actagtgagggacagaaccaggattcagactcaggtccatgggcctggatcactgg

//