ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-01 08:40:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030358 95 bp RNA linear PRI 02-JAN-2023
DEFINITION Homo sapiens microRNA 628 (MIR628), microRNA.
ACCESSION NR_030358
VERSION NR_030358.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 95)
AUTHORS Wang L, Yi X, Xiao X, Zheng Q, Ma L and Li B.
TITLE Exosomal miR-628-5p from M1 polarized macrophages hinders m6A
modification of circFUT8 to suppress hepatocellular carcinoma
progression
JOURNAL Cell Mol Biol Lett 27 (1), 106 (2022)
PUBMED 36474147
REMARK GeneRIF: Exosomal miR-628-5p from M1 polarized macrophages hinders
m6A modification of circFUT8 to suppress hepatocellular carcinoma
progression.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 95)
AUTHORS Zhang J, Wang F, Zhang H and Cao M.
TITLE A novel circular RNA circ_HN1/miR-628-5p/Ecto-5'-nucleotidase
competing endogenous RNA network regulates gastric cancer
development
JOURNAL Bioengineered 12 (2), 9739-9752 (2021)
PUBMED 34637682
REMARK GeneRIF: A novel circular RNA
circ_HN1/miR-628-5p/Ecto-5'-nucleotidase competing endogenous RNA
network regulates gastric cancer development.
REFERENCE 3 (bases 1 to 95)
AUTHORS Ueta M, Nishigaki H, Komai S, Sotozono C and Kinoshita S.
TITLE Difference in the plasma level of miR-628-3p in atopic dermatitis
patients with/without atopic keratoconjunctivitis
JOURNAL Immun Inflamm Dis 9 (4), 1815-1819 (2021)
PUBMED 34547828
REMARK GeneRIF: Difference in the plasma level of miR-628-3p in atopic
dermatitis patients with/without atopic keratoconjunctivitis.
REFERENCE 4 (bases 1 to 95)
AUTHORS Zhao X, Liu Y, Luo C and Zuo Y.
TITLE AGAP2-AS1/miR-628-5p/FOXP2 feedback loop facilitates the growth of
prostate cancer via activating WNT pathway
JOURNAL Carcinogenesis 42 (10), 1270-1280 (2021)
PUBMED 34255057
REMARK GeneRIF: AGAP2-AS1/miR-628-5p/FOXP2 feedback loop facilitates the
growth of prostate cancer via activating WNT pathway.
Erratum:[Carcinogenesis. 2022 Feb 11;43(1):77. PMID: 35078236]
REFERENCE 5 (bases 1 to 95)
AUTHORS Ueta M, Nishigaki H, Mizushima K, Naito Y, Sotozono C and Kinoshita
S.
TITLE Regulation of innate immune response by miR-628-3p upregulated in
the plasma of Stevens-Johnson syndrome patients
JOURNAL Ocul Surf 21, 174-177 (2021)
PUBMED 34058393
REMARK GeneRIF: Regulation of innate immune response by miR-628-3p
upregulated in the plasma of Stevens-Johnson syndrome patients.
REFERENCE 6 (bases 1 to 95)
AUTHORS Tambyah PA, Sepramaniam S, Mohamed Ali J, Chai SC, Swaminathan P,
Armugam A and Jeyaseelan K.
TITLE microRNAs in circulation are altered in response to influenza A
virus infection in humans
JOURNAL PLoS One 8 (10), e76811 (2013)
PUBMED 24116168
REMARK GeneRIF: Data indicate that expression of miR-1260, -26a, -335*,
-576-3p, -628-3p and -664 were consistently dysregulated in both
whole blood and H1N1 infected cells.
Publication Status: Online-Only
REFERENCE 7 (bases 1 to 95)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 8 (bases 1 to 95)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 9 (bases 1 to 95)
AUTHORS Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T,
Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK,
Roberts BS, Juhl H, Kinzler KW, Vogelstein B and Velculescu VE.
TITLE The colorectal microRNAome
JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
PUBMED 16505370
REFERENCE 10 (bases 1 to 95)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC018926.10.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM609581.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-95 AC018926.10 144986-145080 c
FEATURES Location/Qualifiers
source 1..95
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="15"
/map="15q21.3"
gene 1..95
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/note="microRNA 628"
/db_xref="GeneID:693213"
/db_xref="HGNC:HGNC:32884"
/db_xref="miRBase:MI0003642"
precursor_RNA 1..95
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/product="microRNA 628"
/db_xref="GeneID:693213"
/db_xref="HGNC:HGNC:32884"
/db_xref="miRBase:MI0003642"
exon 1..95
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:2056486796"
variation 7
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:991172211"
variation 8
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:1473905485"
variation 10
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:767654407"
variation 11
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="g"
/replace="t"
/db_xref="dbSNP:759658993"
variation 13
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="g"
/replace="t"
/db_xref="dbSNP:2056486457"
variation 14
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/db_xref="dbSNP:751898346"
variation 16
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="c"
/db_xref="dbSNP:959750310"
variation 19
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:766694965"
variation 20
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2056486166"
ncRNA 23..44
/ncRNA_class="miRNA"
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/product="hsa-miR-628-5p"
/db_xref="miRBase:MIMAT0004809"
/db_xref="GeneID:693213"
/db_xref="HGNC:HGNC:32884"
/db_xref="miRBase:MI0003642"
variation 25
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/db_xref="dbSNP:2056486108"
variation 30
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761527552"
variation 31..34
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="at"
/replace="atat"
/db_xref="dbSNP:747172385"
variation 31
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:776423775"
variation 33
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:200771662"
variation 34
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:760615166"
variation 38
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:775387693"
variation 40
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="c"
/db_xref="dbSNP:2141272190"
variation 41
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:771606673"
variation 43
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/db_xref="dbSNP:745373506"
variation 45
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:774044971"
variation 46
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:2056485388"
variation 47..50
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="aaa"
/replace="aaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1330238259"
variation 47
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:770558916"
variation 52
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="g"
/replace="t"
/db_xref="dbSNP:990019453"
variation 53
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323991861"
variation 54
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:1407253165"
variation 55
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="t"
/db_xref="dbSNP:1358908717"
variation 59..63
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1322836365"
variation 59
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157138998"
ncRNA 61..81
/ncRNA_class="miRNA"
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/product="hsa-miR-628-3p"
/db_xref="miRBase:MIMAT0003297"
/db_xref="GeneID:693213"
/db_xref="HGNC:HGNC:32884"
/db_xref="miRBase:MI0003642"
variation 62
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/db_xref="dbSNP:1410255602"
variation 63
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:1401315366"
variation 68
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1158103480"
variation 71
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216611749"
variation 73
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:749619551"
variation 78..82
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace=""
/replace="tcgaa"
/db_xref="dbSNP:148138194"
variation 78
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:778157225"
variation 79
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:756600789"
variation 80
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:2056484329"
variation 81
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:1595835339"
variation 86
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="g"
/db_xref="dbSNP:1595835326"
variation 91
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="g"
/db_xref="dbSNP:1595835322"
variation 93
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="c"
/replace="t"
/db_xref="dbSNP:2056484038"
variation 94
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:539846581"
variation 95
/gene="MIR628"
/gene_synonym="hsa-mir-628; mir-628; MIRN628"
/replace="a"
/replace="t"
/db_xref="dbSNP:1247609413"
ORIGIN
atagctgttgtgtcacttcctcatgctgacatatttactagagggtaaaattaataaccttctagtaagagtggcagtcgaagggaagggctcat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]