ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 17:00:37, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030234 94 bp RNA linear PRI 09-OCT-2022
DEFINITION Homo sapiens microRNA 507 (MIR507), microRNA.
ACCESSION NR_030234
VERSION NR_030234.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 94)
AUTHORS Deng Z, Tu Q, Hu G and Xing M.
TITLE Knockdown of circLRWD1 weakens DDP resistance via reduction of
SIRT5 expression through releasing miR-507 in non-small cell lung
cancer
JOURNAL Anticancer Drugs 33 (9), 861-870 (2022)
PUBMED 35946561
REMARK GeneRIF: Knockdown of circLRWD1 weakens DDP resistance via
reduction of SIRT5 expression through releasing miR-507 in
non-small cell lung cancer.
REFERENCE 2 (bases 1 to 94)
AUTHORS Fang X and Pan A.
TITLE MiR-507 inhibits the progression of gastric carcinoma via targeting
CBX4-mediated activation of Wnt/beta-catenin and HIF-1alpha
pathways
JOURNAL Clin Transl Oncol 24 (10), 2021-2028 (2022)
PUBMED 35819589
REMARK GeneRIF: MiR-507 inhibits the progression of gastric carcinoma via
targeting CBX4-mediated activation of Wnt/beta-catenin and
HIF-1alpha pathways.
REFERENCE 3 (bases 1 to 94)
AUTHORS Li HQ, Fan JJ, Li XH and Bao D.
TITLE MiR-507 inhibits the growth and invasion of trophoblasts by
targeting CAMK4
JOURNAL Eur Rev Med Pharmacol Sci 24 (11), 5856-5862 (2020)
PUBMED 32572897
REMARK GeneRIF: MiR-507 inhibits the growth and invasion of trophoblasts
by targeting CAMK4.
REFERENCE 4 (bases 1 to 94)
AUTHORS Feng X and Yang S.
TITLE Long non-coding RNA LINC00243 promotes proliferation and glycolysis
in non-small cell lung cancer cells by positively regulating PDK4
through sponging miR-507
JOURNAL Mol Cell Biochem 463 (1-2), 127-136 (2020)
PUBMED 31595421
REMARK GeneRIF: LINC00243 modulated expression of endogenous
miR-507-targeted PDK4. LINC00243 promotes proliferation and
glycolysis in NSCLC cells by positively regulating PDK4 through
sponging miR-507.
REFERENCE 5 (bases 1 to 94)
AUTHORS Lv HL, Li ZL and Song YB.
TITLE MicroRNA-507 represses the malignant behaviors of non-small cell
lung cancer via targeting zinc finger E-box binding homeobox 2
JOURNAL Eur Rev Med Pharmacol Sci 23 (22), 9955-9964 (2019)
PUBMED 31799665
REMARK GeneRIF: MicroRNA-507 represses the malignant behaviors of
non-small cell lung cancer via targeting zinc finger E-box binding
homeobox 2.
REFERENCE 6 (bases 1 to 94)
AUTHORS Jia L, Liu W, Cao B, Li H and Yin C.
TITLE MiR-507 inhibits the migration and invasion of human breastcancer
cells through Flt-1 suppression
JOURNAL Oncotarget 7 (24), 36743-36754 (2016)
PUBMED 27167339
REMARK GeneRIF: Results indicate that miR-507 represented potential
therapeutic targets in breast cancer by modulating fms-related
tyrosine kinase-1 (Flt-1).
REFERENCE 7 (bases 1 to 94)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 8 (bases 1 to 94)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 9 (bases 1 to 94)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 10 (bases 1 to 94)
AUTHORS Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O,
Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y and
Bentwich Z.
TITLE Identification of hundreds of conserved and nonconserved human
microRNAs
JOURNAL Nat Genet 37 (7), 766-770 (2005)
PUBMED 15965474
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL589669.11.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM609508.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-94 AL589669.11 119445-119538 c
FEATURES Location/Qualifiers
source 1..94
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq27.3"
gene 1..94
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/note="microRNA 507"
/db_xref="GeneID:574512"
/db_xref="HGNC:HGNC:32144"
/db_xref="miRBase:MI0003194"
precursor_RNA 1..94
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/product="microRNA 507"
/db_xref="GeneID:574512"
/db_xref="HGNC:HGNC:32144"
/db_xref="miRBase:MI0003194"
exon 1..94
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/inference="alignment:Splign:2.1.0"
variation 2
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="g"
/replace="t"
/db_xref="dbSNP:367785813"
variation 5..15
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="tg"
/replace="tgtgtgtagtg"
/db_xref="dbSNP:782563933"
variation 6
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:782247490"
variation 7
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:782002160"
variation 8
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557101472"
variation 9
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="g"
/replace="t"
/db_xref="dbSNP:1199513461"
variation 10
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:2520938447"
variation 13
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557101471"
variation 14
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557101470"
variation 16..25
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="cttcacttca"
/replace="cttcacttcacttca"
/db_xref="dbSNP:2016129042"
variation 17
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:782470769"
variation 19
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:2016129192"
variation 21
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:991990670"
variation 25..26
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2520938341"
variation 26
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/db_xref="dbSNP:1257660734"
variation 28
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:2016128898"
variation 32
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:939168219"
variation 36
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:190684797"
variation 38
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:2520938231"
variation 39
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:782701037"
variation 40
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:782557236"
variation 41
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="g"
/replace="t"
/db_xref="dbSNP:781890357"
variation 42..46
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="tgtct"
/replace="tgtctgtct"
/db_xref="dbSNP:2016128468"
variation 43..45
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="gtc"
/replace="gtcgtc"
/db_xref="dbSNP:1557101465"
variation 45
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:2520938152"
variation 47
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:2520938120"
variation 48
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="g"
/db_xref="dbSNP:2124353299"
variation 50..53
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="aata"
/replace="aataata"
/db_xref="dbSNP:1428373459"
variation 50
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557101464"
variation 54
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:782591384"
variation 55
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:782305586"
ncRNA 56..76
/ncRNA_class="miRNA"
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/product="hsa-miR-507"
/db_xref="miRBase:MIMAT0002879"
/db_xref="GeneID:574512"
/db_xref="HGNC:HGNC:32144"
/db_xref="miRBase:MI0003194"
variation 62
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:1569536825"
variation 63
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557101459"
variation 65
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="g"
/replace="t"
/db_xref="dbSNP:781966667"
variation 68
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:782742636"
variation 72
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="g"
/replace="t"
/db_xref="dbSNP:2016127938"
variation 74
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557101455"
variation 76..81
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="aataat"
/replace="aataataat"
/db_xref="dbSNP:2016127709"
variation 76
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/db_xref="dbSNP:782056498"
variation 78..81
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="taat"
/replace="taattaat"
/db_xref="dbSNP:782554848"
variation 79
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:782575701"
variation 81
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1464780225"
variation 83
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312470568"
variation 85
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="c"
/replace="g"
/db_xref="dbSNP:2520937875"
variation 87
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1376246701"
variation 88
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2016127263"
variation 89..93
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="agata"
/replace="agatagata"
/db_xref="dbSNP:781897109"
variation 89
/gene="MIR507"
/gene_synonym="hsa-mir-507; mir-507; MIRN507"
/replace="a"
/replace="g"
/db_xref="dbSNP:782415273"
ORIGIN
gtgctgtgtgtagtgcttcacttcaagaagtgccatgcatgtgtctagaaatatgttttgcaccttttggagtgaaataatgcacaacagatac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]