ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-04-05 00:14:01, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NR_029610 110 bp RNA linear PRI 17-NOV-2024
DEFINITION Homo sapiens microRNA 34a (MIR34A), microRNA.
ACCESSION NR_029610
VERSION NR_029610.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 110)
AUTHORS Dasgupta,R., Becker,W. and Petzold,K.
TITLE Elucidating microRNA-34a organisation within human Argonaute-2 by
dynamic nuclear polarisation-enhanced magic angle spinning NMR
JOURNAL Nucleic Acids Res 52 (19), 11995-12004 (2024)
PUBMED 39228364
REMARK GeneRIF: Elucidating microRNA-34a organisation within human
Argonaute-2 by dynamic nuclear polarisation-enhanced magic angle
spinning NMR.
REFERENCE 2 (bases 1 to 110)
AUTHORS Acosta-Plasencia,M., Castellano,J.J., Diaz,T., He,Y., Marrades,R.M.
and Navarro,A.
TITLE Discovering genes and microRNAs involved in human lung development
unveils IGFBP3/miR-34a dynamics and their relevance for alveolar
differentiation
JOURNAL Stem Cell Res Ther 15 (1), 263 (2024)
PUBMED 39183355
REMARK GeneRIF: Discovering genes and microRNAs involved in human lung
development unveils IGFBP3/miR-34a dynamics and their relevance for
alveolar differentiation.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 110)
AUTHORS He,F., Yu,J., Ma,S., Zhao,W., Wang,Q., He,H., Zhang,M., Wang,J. and
Lu,Z.
TITLE MiR-34a promotes mitochondrial pathway of apoptosis in human
salivary gland epithelial cells by activating NF-kappaB signaling
JOURNAL Arch Biochem Biophys 758, 110063 (2024)
PUBMED 38880321
REMARK GeneRIF: MiR-34a promotes mitochondrial pathway of apoptosis in
human salivary gland epithelial cells by activating NF-kappaB
signaling.
REFERENCE 4 (bases 1 to 110)
AUTHORS Sun,Y., Zhang,C., Ma,Q., Yu,X., Gao,X., Zhang,H., Shi,Y., Li,Y. and
He,X.
TITLE MiR-34a-HK1 signal axis retards bone marrow mesenchymal stem cell
senescence via ameliorating glycolytic metabolism
JOURNAL Stem Cell Res Ther 15 (1), 238 (2024)
PUBMED 39080798
REMARK GeneRIF: MiR-34a-HK1 signal axis retards bone marrow mesenchymal
stem cell senescence via ameliorating glycolytic metabolism.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 110)
AUTHORS Hermeking,H.
TITLE The miR-34 family in cancer and apoptosis
JOURNAL Cell Death Differ 17 (2), 193-199 (2010)
PUBMED 19461653
REMARK GeneRIF: evidence for a role of miR-34a and miR-34b/c in the
apoptotic response of normal and tumor cells
Review article
REFERENCE 6 (bases 1 to 110)
AUTHORS Welch,C., Chen,Y. and Stallings,R.L.
TITLE MicroRNA-34a functions as a potential tumor suppressor by inducing
apoptosis in neuroblastoma cells
JOURNAL Oncogene 26 (34), 5017-5022 (2007)
PUBMED 17297439
REMARK GeneRIF: miR-34a directly targets the mRNA encoding E2F3 and
significantly reduces the levels of E2F3 protein in neuroblastoma
cells.
REFERENCE 7 (bases 1 to 110)
AUTHORS Raver-Shapira,N., Marciano,E., Meiri,E., Spector,Y., Rosenfeld,N.,
Moskovits,N., Bentwich,Z. and Oren,M.
TITLE Transcriptional activation of miR-34a contributes to p53-mediated
apoptosis
JOURNAL Mol Cell 26 (5), 731-743 (2007)
PUBMED 17540598
REFERENCE 8 (bases 1 to 110)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 9 (bases 1 to 110)
AUTHORS Lim,L.P., Glasner,M.E., Yekta,S., Burge,C.B. and Bartel,D.P.
TITLE Vertebrate microRNA genes
JOURNAL Science 299 (5612), 1540 (2003)
PUBMED 12624257
REFERENCE 10 (bases 1 to 110)
AUTHORS Dostie,J., Mourelatos,Z., Yang,M., Sharma,A. and Dreyfuss,G.
TITLE Numerous microRNPs in neuronal cells containing novel microRNAs
JOURNAL RNA 9 (2), 180-186 (2003)
PUBMED 12554860
REMARK Erratum:[RNA. 2003 May;9(5):631-2]
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL591166.12.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. This miRNA is a member of the highly
conserved miR-34 family. This miRNA functions as a tumor suppressor
and dysregulation or loss of the host gene from which this miRNA is
processed is associated with cancer progression in numerous cell
types. [provided by RefSeq, Sep 2015].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM608342.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-110 AL591166.12 20546-20655 c
FEATURES Location/Qualifiers
source 1..110
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p36.22"
gene 1..110
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/note="microRNA 34a"
/db_xref="GeneID:407040"
/db_xref="HGNC:HGNC:31635"
/db_xref="MIM:611172"
/db_xref="miRBase:MI0000268"
precursor_RNA 1..110
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/product="microRNA 34a"
/db_xref="GeneID:407040"
/db_xref="HGNC:HGNC:31635"
/db_xref="MIM:611172"
/db_xref="miRBase:MI0000268"
exon 1..110
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:372904298"
variation 2
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:999624620"
variation 3..4
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1639425387"
variation 3
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:780461995"
variation 6
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="t"
/db_xref="dbSNP:1483864352"
variation 7
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="g"
/db_xref="dbSNP:2521406798"
variation 9..15
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="gtg"
/replace="gtgagtg"
/db_xref="dbSNP:1208438106"
variation 11..13
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="gag"
/db_xref="dbSNP:768855806"
ncRNA 22..43
/ncRNA_class="miRNA"
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/product="hsa-miR-34a-5p"
/db_xref="miRBase:MIMAT0000255"
/db_xref="GeneID:407040"
/db_xref="HGNC:HGNC:31635"
/db_xref="MIM:611172"
/db_xref="miRBase:MI0000268"
variation 22
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="t"
/db_xref="dbSNP:1639425241"
variation 24
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:756492579"
variation 25
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407488784"
variation 26
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:369892834"
variation 34
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="t"
/db_xref="dbSNP:750826817"
variation 35
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:35301225"
variation 36
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="c"
/db_xref="dbSNP:1230701086"
variation 39
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:768065817"
variation 47
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="t"
/db_xref="dbSNP:2521406753"
variation 49
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:762439387"
variation 51
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1639424828"
variation 55
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:72631823"
variation 56..57
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace=""
/replace="g"
/db_xref="dbSNP:1639424704"
variation 59
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:574713255"
variation 60
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379763179"
variation 63
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="g"
/db_xref="dbSNP:1039234683"
ncRNA 64..85
/ncRNA_class="miRNA"
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/product="hsa-miR-34a-3p"
/db_xref="miRBase:MIMAT0004557"
/db_xref="GeneID:407040"
/db_xref="HGNC:HGNC:31635"
/db_xref="MIM:611172"
/db_xref="miRBase:MI0000268"
variation 64
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639424511"
variation 65
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:2521406716"
variation 66
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489276188"
variation 69
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="c"
/db_xref="dbSNP:1357866392"
variation 71
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:763206520"
variation 80
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639424340"
variation 86
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1639424295"
variation 87
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:775644632"
variation 90
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="g"
/db_xref="dbSNP:201359809"
variation 91
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="t"
/db_xref="dbSNP:2521406673"
variation 94
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168775113"
variation 98
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639424124"
variation 99
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:534804406"
variation 102
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1639424022"
variation 103
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1387857281"
variation 103
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="t"
/replace="tt"
/db_xref="dbSNP:763355454"
variation 104
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1458052362"
variation 107
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="g"
/replace="t"
/db_xref="dbSNP:1174902187"
variation 108
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1434793716"
variation 109
/gene="MIR34A"
/gene_synonym="mir-34; mir-34a; MIRN34A; miRNA34A"
/replace="a"
/replace="c"
/db_xref="dbSNP:2521406629"
ORIGIN
ggccagctgtgagtgtttctttggcagtgtcttagctggttgttgtgagcaatagtaaggaagcaatcagcaagtatactgccctagaagtgctgcacgttgtggggccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]