ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-03 19:00:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_022145 1731 bp mRNA linear PRI 02-AUG-2023
DEFINITION Homo sapiens centromere protein K (CENPK), transcript variant 1,
mRNA.
ACCESSION NM_022145
VERSION NM_022145.5
KEYWORDS RefSeq; MANE Select.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1731)
AUTHORS Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
and Wu XL.
TITLE Lentivirus-mediated short hairpin RNA interference of CENPK
inhibits growth of colorectal cancer cells with overexpression of
Cullin 4A
JOURNAL World J Gastroenterol 28 (37), 5420-5443 (2022)
PUBMED 36312839
REMARK GeneRIF: Lentivirus-mediated short hairpin RNA interference of
CENPK inhibits growth of colorectal cancer cells with
overexpression of Cullin 4A.
REFERENCE 2 (bases 1 to 1731)
AUTHORS Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
Zang J and Yao X.
TITLE Structural insights into human CCAN complex assembled onto DNA
JOURNAL Cell Discov 8 (1), 90 (2022)
PUBMED 36085283
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1731)
AUTHORS Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
S, Ma Y, Cai H and Guo T.
TITLE Centromeric protein K (CENPK) promotes gastric cancer proliferation
and migration via interacting with XRCC5
JOURNAL Gastric Cancer 25 (5), 879-895 (2022)
PUBMED 35715658
REMARK GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
proliferation and migration via interacting with XRCC5.
REFERENCE 4 (bases 1 to 1731)
AUTHORS Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
TITLE N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
cervical cancer stemness and chemoresistance
JOURNAL Mil Med Res 9 (1), 19 (2022)
PUBMED 35418160
REMARK GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
promotes cervical cancer stemness and chemoresistance.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1731)
AUTHORS Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
TITLE Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration
JOURNAL Bioengineered 12 (1), 1299-1310 (2021)
PUBMED 33904381
REMARK GeneRIF: Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration.
REFERENCE 6 (bases 1 to 1731)
AUTHORS Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
Desai A and Fukagawa T.
TITLE The CENP-H-I complex is required for the efficient incorporation of
newly synthesized CENP-A into centromeres
JOURNAL Nat Cell Biol 8 (5), 446-457 (2006)
PUBMED 16622420
REFERENCE 7 (bases 1 to 1731)
AUTHORS Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
Cleveland DW.
TITLE The human CENP-A centromeric nucleosome-associated complex
JOURNAL Nat Cell Biol 8 (5), 458-469 (2006)
PUBMED 16622419
REFERENCE 8 (bases 1 to 1731)
AUTHORS Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
TITLE Proteomics analysis of the centromere complex from HeLa interphase
cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
the CEN-complex, while BMI-1 is transiently co-localized with the
centromeric region in interphase
JOURNAL Genes Cells 9 (2), 105-120 (2004)
PUBMED 15009096
REFERENCE 9 (bases 1 to 1731)
AUTHORS Yamashita A, Ito M, Takamatsu N and Shiba T.
TITLE Characterization of Solt, a novel SoxLZ/Sox6 binding protein
expressed in adult mouse testis
JOURNAL FEBS Lett 481 (2), 147-151 (2000)
PUBMED 10996314
REFERENCE 10 (bases 1 to 1731)
AUTHORS Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
K, Yokota J and Morishita K.
TITLE Fusion of the MLL gene with two different genes, AF-6 and
AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
and 11 in infant leukemia
JOURNAL Oncogene 13 (10), 2121-2130 (1996)
PUBMED 8950979
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BC008504.1.
On Nov 24, 2018 this sequence version replaced NM_022145.4.
Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
300065)-associated centromeric complex that targets CENPA (MIM
117139) to centromeres and is required for proper kinetochore
function and mitotic progression (Okada et al., 2006 [PubMed
16622420]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (1) represents the longest
transcript. Variants 1 and 2 encode the same isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC008504.1, SRR1163658.452865.1
[ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
MANE Ensembl match :: ENST00000396679.6/ ENSP00000379911.1
RefSeq Select criteria :: based on conservation, expression
##RefSeq-Attributes-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1731 BC008504.1 1-1731
FEATURES Location/Qualifiers
source 1..1731
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q12.3"
gene 1..1731
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="centromere protein K"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
exon 1..71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359976795"
variation 2
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313487734"
variation 3
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752349587"
variation 6
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752348893"
variation 7
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752348579"
variation 8
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306504051"
variation 9
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342831242"
variation 11..20
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ggggctggca"
/replace="ggggctggcaggggctggca"
/db_xref="dbSNP:1485277906"
variation 11
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752347563"
variation 12
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231982437"
variation 13
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028359789"
variation 14
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:542352928"
variation 15
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210224911"
variation 19
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265798087"
variation 21
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752345149"
variation 22..25
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gc"
/replace="gcgc"
/db_xref="dbSNP:1257636747"
variation 24
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1226707165"
variation 28
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752344063"
variation 29
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752343711"
variation 30
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:748792667"
variation 31
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1422047918"
variation 32
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1412446096"
variation 33
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473419782"
variation 34
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150581284"
variation 35
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752342051"
variation 36
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1343690787"
variation 37
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140804671"
variation 39
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:553552680"
variation 40
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752340528"
variation 41
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:9791024"
variation 42
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404435189"
variation 45
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1413477558"
variation 46
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011178654"
variation 48
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:892736211"
variation 49
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1293152372"
variation 50
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1752337962"
variation 52
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004353263"
variation 53
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364825946"
variation 55
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752336831"
variation 56
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:41268429"
variation 61
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027093258"
variation 62
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003673595"
variation 63
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:995243929"
variation 64
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:558001621"
variation 69
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1368732818"
variation 71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157875168"
exon 72..173
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 72
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:548499564"
variation 75..77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tag"
/replace="tagttag"
/db_xref="dbSNP:1038778849"
variation 77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757254302"
variation 84
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1751964644"
variation 85
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225478568"
variation 86
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375448951"
variation 90
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751963569"
variation 93
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001509723"
variation 94
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445804221"
variation 99
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171663462"
variation 101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581126138"
variation 103
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374448596"
variation 104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:906122153"
variation 107
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:902390139"
variation 114
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470058908"
variation 115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751960081"
variation 119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1581126047"
variation 127
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150571791"
variation 129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358207757"
variation 130
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173365559"
variation 131
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751958616"
variation 133
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330586449"
variation 134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1337771016"
variation 135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401876701"
variation 137
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1440214129"
variation 140
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581125889"
variation 145
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1751955831"
variation 146
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751955343"
variation 148
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409398045"
variation 155
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:189373120"
variation 165
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1158620897"
variation 168
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751953447"
variation 170
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1024707099"
variation 171
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:950264084"
variation 172
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1013728629"
variation 173
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053275890"
exon 174..323
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 178
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443766369"
variation 181
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750737523"
variation 182..185
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ataa"
/replace="ataataa"
/db_xref="dbSNP:1256234642"
variation 182
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:760138230"
variation 186
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:542351057"
misc_feature 189..191
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="upstream in-frame stop codon"
variation 193
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:551599072"
variation 194
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184278791"
variation 195
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164611338"
variation 200
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:748100479"
variation 201
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411927803"
variation 203
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:988842021"
variation 205
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172936444"
variation 207
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:778744562"
variation 210
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403246344"
variation 212
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486299502"
CDS 213..1022
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="isoform 1 is encoded by transcript variant 1;
leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
Solt; protein AF-5alpha; interphase centromere complex
protein 37"
/codon_start=1
/product="centromere protein K isoform 1"
/protein_id="NP_071428.2"
/db_xref="CCDS:CCDS3984.1"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
/translation="
MNQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
misc_feature 213..272
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="propagated from UniProtKB/Swiss-Prot (Q9BS16.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 240..1019
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Centromere-associated protein K; Region: CENP-K;
pfam11802"
/db_xref="CDD:432085"
misc_feature 498..503
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Breakpoint for translocation to form
KMT2A/MLL1-CENPK oncogene; propagated from
UniProtKB/Swiss-Prot (Q9BS16.1); other site"
variation 213
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750731325"
variation 215
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:749023060"
variation 219
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139570970"
variation 223
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757460492"
variation 225
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777895549"
variation 229
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2096371242"
variation 231
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:935938524"
variation 234
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150532568"
variation 235
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:758896315"
variation 236
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:75497175"
variation 238
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1216026136"
variation 241
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:371070860"
variation 248
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750726023"
variation 249
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:760004670"
variation 250
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750725249"
variation 258
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397513933"
variation 259
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750724525"
variation 260
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:754218341"
variation 261
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:766178671"
variation 265
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:760347848"
variation 267
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348543974"
variation 270..274
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="actga"
/db_xref="dbSNP:1429400174"
variation 272
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:772652364"
variation 273..281
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gaagaa"
/replace="gaagaagaa"
/db_xref="dbSNP:1347528124"
variation 278
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423115596"
variation 279
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750721303"
variation 282
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150574725"
variation 284
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:201745679"
variation 286
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481438294"
variation 287
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774283954"
variation 288
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141729484"
variation 291
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206680426"
variation 295
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581093357"
variation 301..303
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1437145639"
variation 301
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248409774"
variation 302
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750716760"
variation 304
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:749111718"
variation 308
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750714903"
variation 309
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263513424"
variation 312
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:775244207"
variation 315
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771118232"
variation 316
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:747252575"
variation 321
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868732343"
exon 324..380
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750271640"
variation 325
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543487501"
variation 326
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043343369"
variation 327
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750268417"
variation 338
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448020199"
variation 339
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762865136"
variation 342
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775330841"
variation 344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:148016416"
variation 345
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750263924"
variation 346..348
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ttg"
/db_xref="dbSNP:779227890"
variation 346
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454849271"
variation 348
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:144481454"
variation 349
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150519689"
variation 351
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:745593902"
variation 356..367
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aacactcaccga"
/db_xref="dbSNP:1242902542"
variation 358..364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cac"
/replace="cactcac"
/db_xref="dbSNP:757802386"
variation 358
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:946304876"
variation 360
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:138527872"
variation 362
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339735347"
variation 364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150519582"
variation 365
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757907403"
variation 366
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141548635"
variation 370
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:201709067"
variation 377
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:755596314"
variation 378
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:764377925"
exon 381..453
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749320661"
variation 383
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:780631678"
variation 387..391
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:1750067937"
variation 387
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750068401"
variation 395
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750067487"
variation 397
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:532263854"
variation 398
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328421596"
variation 399
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750066060"
variation 401
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750065565"
variation 402
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278922834"
variation 407
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:746283375"
variation 410..412
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1388017290"
variation 416
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:781388497"
variation 417
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751218204"
variation 418
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406983239"
variation 423
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391243960"
variation 424..430
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tca"
/replace="tcagtca"
/db_xref="dbSNP:762598205"
variation 424
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1561685621"
variation 425
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:777349763"
variation 426
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185445391"
variation 427
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425260470"
variation 431
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749780402"
variation 432
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750057694"
variation 434
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1477188242"
variation 435
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1750056781"
variation 437
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750056286"
variation 438..444
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:750256768"
variation 440
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:377608156"
variation 444
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:549718297"
variation 445
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750053838"
variation 446
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:759373577"
variation 447
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753728671"
variation 450
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561685364"
variation 453
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1693238677"
exon 454..500
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 456
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438182467"
variation 459
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:557986609"
variation 461
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:764452510"
variation 463
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:763064949"
variation 464
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1483041739"
variation 465
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212552"
variation 468
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212077"
variation 469..470
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:1403653612"
variation 473
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765236390"
variation 474
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548653305"
variation 476
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771385648"
variation 477
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1286587676"
variation 479
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:138507676"
variation 483
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314951065"
variation 484
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:974580309"
variation 487
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773540586"
variation 489..490
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1581021207"
variation 490
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150453321"
variation 494
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581021175"
variation 496..497
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:779363914"
variation 496..497
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1748205064"
variation 497
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228585329"
exon 501..583
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 503
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393117032"
variation 506
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180206825"
variation 512
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150375703"
variation 516
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773628734"
variation 520
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237140365"
variation 529
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232231851"
variation 531
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1193606113"
variation 532
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745284481"
variation 533
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:547550705"
variation 534
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745283514"
variation 536
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1186908669"
variation 540
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748490924"
variation 541
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773901255"
variation 544
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2150375557"
variation 550
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:768317556"
variation 551
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1561634678"
variation 553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748850005"
variation 556
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745280061"
variation 557
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145897680"
variation 558
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:753691260"
variation 563
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376463567"
variation 564
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327050486"
variation 566..569
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aaag"
/db_xref="dbSNP:2150375437"
variation 571
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:140748564"
variation 573
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1286143770"
variation 574
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1745276214"
variation 575
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:745797201"
variation 576
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1302333711"
variation 578
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434037126"
variation 580
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580930674"
variation 581
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:909927578"
exon 584..682
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 586
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745248317"
variation 587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195109001"
variation 588
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745247359"
variation 590
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185309293"
variation 591
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755218264"
variation 592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138940796"
variation 597
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745244701"
variation 599
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357350104"
variation 600
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265044045"
variation 601
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:892129867"
variation 602
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561633837"
variation 603
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:867891240"
variation 603
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1745242213"
variation 604
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:780195488"
variation 605..636
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ac"
/replace="acagcaacagataatggaatctcttaatgtac"
/db_xref="dbSNP:1745237533"
variation 611
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157077028"
variation 614
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363410017"
variation 623
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756212865"
variation 626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:750466231"
variation 630
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1325715984"
variation 633
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:767952170"
variation 635
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406824741"
variation 636
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580929057"
variation 638
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:150254661"
variation 640
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451415236"
variation 641
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745235605"
variation 642
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580928949"
variation 643..644
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="a"
/db_xref="dbSNP:749771436"
variation 643
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751927567"
variation 644
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:141033147"
variation 649
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:775303734"
variation 650
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1471995857"
variation 656
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425234534"
variation 658
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323742457"
variation 660
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745230797"
variation 664
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:540839130"
variation 665
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229775"
variation 668
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229292"
variation 669
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475383930"
variation 673
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1240814809"
variation 674
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1201507225"
variation 675
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452590609"
variation 679
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:199710596"
variation 680
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:776182305"
variation 681
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:770828450"
exon 683..809
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745162523"
variation 689
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1192069105"
variation 702
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745161624"
variation 705..708
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1238965408"
variation 707
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745161152"
variation 708
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:752112029"
variation 712
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1203948509"
variation 714
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150372287"
variation 717
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745159363"
variation 720
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745158892"
variation 723
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:764451391"
variation 724
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:758865586"
variation 725
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:753079695"
variation 729
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765028924"
variation 731
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376864120"
variation 740
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745154105"
variation 743..745
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gag"
/db_xref="dbSNP:1231746887"
variation 743
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216777810"
variation 744
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745152720"
variation 748
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378696125"
variation 755
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:538146502"
variation 756
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868259372"
variation 758
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745150168"
variation 761
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745149712"
variation 762
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:765914401"
variation 763
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185768219"
variation 766
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:569355500"
variation 767
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377239133"
variation 768
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773227049"
variation 770
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745146291"
variation 771
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745145818"
variation 773
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172188810"
variation 777
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:866918568"
variation 778
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771962047"
variation 780
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774114264"
variation 782
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176885832"
variation 783
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468783521"
variation 788
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:770061194"
variation 790
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:151068525"
variation 793
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:781204320"
variation 794
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:759021447"
variation 798..802
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1284629517"
variation 800
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745140405"
variation 804..808
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1745137975"
variation 804
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757372616"
variation 809
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409007703"
exon 810..863
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 810
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213991862"
variation 811..821
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaaacattcaa"
/db_xref="dbSNP:1743744485"
variation 814
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:774200181"
variation 816
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1270744844"
variation 817
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561615890"
variation 819
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219885542"
variation 823
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308635150"
variation 829
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:759382373"
variation 840
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:776934831"
variation 841
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580880398"
variation 845
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:376455824"
variation 848
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743741013"
variation 850
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:747162578"
variation 855
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743739935"
variation 857
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440453004"
variation 863
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:777984796"
exon 864..1731
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 865
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193515151"
variation 866
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457022289"
variation 869
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407171241"
variation 870..876
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ata"
/replace="ataaata"
/db_xref="dbSNP:1410263007"
variation 870
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484537441"
variation 871
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:779591294"
variation 873..876
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aata"
/db_xref="dbSNP:774484343"
variation 874
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210752666"
variation 876
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346222240"
variation 877..880
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gatt"
/db_xref="dbSNP:1240110785"
variation 882..884
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1161999795"
variation 882
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1322275300"
variation 886
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335325956"
variation 888
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:769017086"
variation 893
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749715663"
variation 894
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755866468"
variation 895..906
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atg"
/replace="atgatccatatg"
/db_xref="dbSNP:1329394537"
variation 895..896
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1373474133"
variation 895
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:542463893"
variation 896
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145412104"
variation 897..898
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tttttt"
/db_xref="dbSNP:771313026"
variation 900
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:960235172"
variation 901
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454009624"
variation 902
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362811635"
variation 905
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580864222"
variation 906
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743131833"
variation 909..912
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1743131212"
variation 914
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:756782808"
variation 916
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:368786771"
variation 918
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1257572242"
variation 926
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:919152018"
variation 928
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489193688"
variation 929
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034387973"
variation 930..931
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:749720138"
variation 931
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1484974307"
variation 932
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:112503088"
variation 934
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001989973"
variation 935
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:899250076"
variation 938
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762786158"
variation 948
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1016654387"
variation 950
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141551708"
variation 952
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206028496"
variation 954
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:752602369"
variation 955
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:147863579"
variation 956
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004913643"
variation 957
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1207772442"
variation 958
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:759344010"
variation 959
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161689071"
variation 960
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743117164"
variation 963
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1386097326"
variation 968
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:528929654"
variation 969..970
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1580863575"
variation 972
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743115124"
variation 974
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1001577205"
variation 976
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1334649862"
variation 982
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:773588233"
variation 984
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:772376049"
variation 985
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414102882"
variation 987
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1350727271"
variation 991
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:762026997"
variation 993
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774554899"
variation 994
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749758005"
variation 996
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:746284263"
variation 998
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:775999649"
variation 1000
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:375568861"
variation 1002
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:746181867"
variation 1006
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1163495587"
variation 1008
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228791496"
variation 1009
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:933805256"
variation 1010
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1279834410"
variation 1013
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1487486189"
variation 1015
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1244285837"
variation 1019
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:36068055"
variation 1025
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756880796"
variation 1030..1033
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743101471"
variation 1035
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260071196"
variation 1036
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:746580111"
variation 1037
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1469027129"
variation 1038
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:777142009"
variation 1040
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:757857332"
variation 1041
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="c"
/db_xref="dbSNP:1472961778"
variation 1042
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:748983371"
variation 1044
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:942422849"
variation 1045
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:752587413"
variation 1049..1053
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1410026237"
variation 1049
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765169647"
variation 1050
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743095898"
variation 1054
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1554102945"
variation 1055
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743094716"
variation 1056
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754847602"
variation 1057
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:753650693"
variation 1060
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:149505574"
variation 1061
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172922491"
variation 1062
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394689518"
variation 1070
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:762116904"
variation 1071..1074
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tatt"
/db_xref="dbSNP:1743090541"
variation 1071
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1459452062"
variation 1072
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:774559990"
variation 1073
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743091117"
variation 1085
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1649200052"
variation 1086
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743090066"
variation 1088
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329637299"
variation 1090
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:904709766"
variation 1094
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743088868"
variation 1097
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1039179836"
variation 1098
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150328447"
variation 1099
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1312201262"
variation 1102..1104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aca"
/db_xref="dbSNP:1561607792"
variation 1103..1105
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="cat"
/db_xref="dbSNP:1743086947"
variation 1108
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743086428"
variation 1111
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743085588"
variation 1115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743084567"
variation 1116
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370569166"
variation 1119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743083080"
variation 1121
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743082614"
variation 1122
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:978818163"
variation 1123
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577792004"
variation 1124
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349464377"
variation 1125
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:945753719"
variation 1126
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:913482577"
variation 1129..1135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gccatct"
/db_xref="dbSNP:3050538"
variation 1129..1135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gccatct"
/replace="gccatctgccatct"
/db_xref="dbSNP:2150328214"
variation 1129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1580862389"
variation 1133..1136
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tctt"
/db_xref="dbSNP:764130293"
variation 1134..1140
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ctt"
/replace="cttactt"
/db_xref="dbSNP:750310884"
variation 1134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:993073629"
variation 1135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:199686668"
variation 1137
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:960287476"
variation 1138
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:557852862"
variation 1143
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150328136"
variation 1148
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1217910725"
variation 1149
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:11952932"
variation 1153
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743074804"
variation 1154
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207342510"
variation 1156
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051477604"
variation 1161
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:980313749"
variation 1163
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379083883"
variation 1165
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743072067"
variation 1166
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771152778"
variation 1168
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1476923760"
variation 1170
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963780201"
variation 1184
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172842501"
variation 1186
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743069976"
variation 1192
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743069574"
variation 1194
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743069146"
variation 1195
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743068751"
variation 1203
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016373653"
variation 1217
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743067853"
variation 1221
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743067391"
variation 1222
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743066970"
variation 1226
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743066553"
variation 1227
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743066123"
variation 1229
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377015673"
variation 1230
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743065238"
variation 1231
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1431598611"
variation 1232
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1476832769"
variation 1243
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063753"
variation 1244
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063346"
variation 1247
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062908"
variation 1249
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062518"
variation 1263
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005290916"
variation 1266
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743061710"
variation 1269
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743061305"
variation 1273
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395176719"
variation 1274..1275
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743060475"
variation 1276
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:950730610"
variation 1277
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:918903214"
variation 1281..1285
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cttac"
/replace="cttacttac"
/db_xref="dbSNP:1743058362"
variation 1283
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743059183"
variation 1284
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1580861850"
variation 1285
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743057940"
variation 1286
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1030344060"
variation 1289
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:998061561"
variation 1292
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743056633"
variation 1294
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743056190"
variation 1297..1301
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1379062344"
variation 1300
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743055799"
variation 1307
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232536793"
variation 1308
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743054584"
variation 1310
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:901106029"
variation 1317..1319
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:2150327537"
variation 1324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303180714"
variation 1330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743053398"
variation 1334
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963227783"
variation 1352
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039911851"
variation 1353
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:926467233"
variation 1354
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743050692"
variation 1356..1357
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743050266"
variation 1358
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1231285212"
variation 1360
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743049462"
variation 1362
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138007557"
variation 1364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743048540"
variation 1365
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338827386"
variation 1369
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1210597400"
variation 1369
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743047305"
variation 1371
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743046847"
variation 1372
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327342"
variation 1374..1377
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743045993"
variation 1374
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1269715863"
variation 1378
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260858610"
variation 1384
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327288"
variation 1388
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1195775126"
variation 1389
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:970156172"
variation 1395
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150327248"
variation 1396
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743044194"
variation 1406
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:555421066"
variation 1413
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743043231"
variation 1414
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743042786"
variation 1416
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743042345"
variation 1418
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743041595"
variation 1421
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1248470707"
variation 1424
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:535728857"
variation 1426
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743040225"
variation 1427
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743039797"
variation 1430
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743039346"
variation 1436
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038929"
variation 1442
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038506"
variation 1447
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743038099"
variation 1448..1451
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1743037214"
variation 1449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743037649"
variation 1452..1453
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743036202"
variation 1452
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:181291384"
variation 1455
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:956248428"
variation 1456
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1457981299"
variation 1457
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:191377833"
variation 1458..1462
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1743032082"
variation 1458
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743033537"
variation 1460
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:539417576"
variation 1464
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1164554935"
variation 1466
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743030703"
variation 1468
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042853202"
variation 1471
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1199984915"
variation 1482
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1388092390"
variation 1488
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743028067"
variation 1492
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1343109599"
variation 1493
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1031647042"
variation 1494
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437815344"
variation 1495
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743024787"
variation 1498
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743024219"
variation 1500
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743023557"
variation 1501
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294075340"
variation 1507
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:945709709"
variation 1509
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150326827"
variation 1510
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021901"
variation 1511
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1326412701"
variation 1513
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021208"
variation 1516
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000450375"
variation 1517..1518
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tt"
/db_xref="dbSNP:1743019563"
variation 1519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:374187039"
variation 1526
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1743018191"
variation 1532
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743017506"
variation 1533
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354485971"
variation 1534
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056728221"
variation 1540
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743016253"
variation 1541
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1213331032"
variation 1546
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268486647"
variation 1557
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743014908"
variation 1559..1560
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1743014111"
variation 1559
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743014523"
variation 1560
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1039250611"
variation 1561
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743013272"
variation 1565
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743012845"
variation 1573
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186533991"
variation 1577
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011987"
variation 1580
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011557"
variation 1584..1587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743010647"
variation 1584
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1340299966"
variation 1587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743010222"
variation 1592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424395658"
variation 1593
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:532743192"
variation 1594..1601
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tatta"
/replace="tattatta"
/db_xref="dbSNP:1743008574"
variation 1595
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366225240"
variation 1600..1604
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1159449444"
variation 1601
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1460556343"
variation 1604..1610
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="atatcat"
/db_xref="dbSNP:1459141015"
variation 1605
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1389766148"
variation 1606
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743006871"
variation 1609
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743006467"
variation 1613
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:927562539"
variation 1614
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150326376"
variation 1615
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743005152"
variation 1616
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743004554"
variation 1619
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1287552641"
variation 1621
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361828535"
variation 1623
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:980658237"
variation 1627
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314885435"
variation 1628
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743001315"
variation 1632
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743000469"
variation 1637
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1353680059"
variation 1640
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1327594781"
variation 1641
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051966282"
variation 1646
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1289235686"
variation 1647..1653
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atta"
/replace="attatta"
/db_xref="dbSNP:1331567359"
variation 1650
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742997647"
variation 1652
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742996975"
variation 1654
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742995591"
variation 1657
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1742994796"
variation 1658
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:929048520"
variation 1660
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:369693784"
variation 1678
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1259977140"
variation 1685
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1483507690"
variation 1686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202138533"
variation 1687
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742990821"
variation 1691..1694
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:897488737"
variation 1699
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176718170"
variation 1705..1713
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaat"
/replace="aaataaaat"
/db_xref="dbSNP:1421192369"
regulatory 1706..1711
/regulatory_class="polyA_signal_sequence"
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="hexamer: AATAAA"
variation 1707
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1464857841"
variation 1712..1717
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="att"
/replace="attatt"
/db_xref="dbSNP:1580860318"
variation 1720
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742987371"
variation 1721
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742986932"
variation 1728
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:879097828"
variation 1729
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1182336846"
polyA_site 1731
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="major polyA site"
ORIGIN
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggttacatacagcttacatcttgcatcctcaagcgtttttcttataaggctaaaaattcacaaagcatatatcaatgaatcaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]