ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-01-31 01:10:58, GGRNA.v2 : RefSeq release 227 (Nov, 2024)
LOCUS NM_012199 13712 bp mRNA linear PRI 20-SEP-2024
DEFINITION Homo sapiens argonaute RISC component 1 (AGO1), transcript variant
1, mRNA.
ACCESSION NM_012199
VERSION NM_012199.5
KEYWORDS RefSeq; MANE Select.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 13712)
AUTHORS Fang,X., Ren,L.H., Shrestha,S.M., Ji,Q., Xu,Z., Wang,D., Ding,Q.,
Liang,X. and Shi,R.H.
TITLE LINC01116 modulates EMT process via binding with AGO1 mRNA in
oesophageal squamous cell carcinoma
JOURNAL Biochim Biophys Acta Mol Cell Res 1870 (5), 119447 (2023)
PUBMED 36990227
REMARK GeneRIF: LINC01116 modulates EMT process via binding with AGO1 mRNA
in oesophageal squamous cell carcinoma.
REFERENCE 2 (bases 1 to 13712)
AUTHORS Kowalczyk,M., Kowalczyk,E., Galita,G., Majsterek,I., Talarowska,M.,
Poplawski,T., Kwiatkowski,P., Lichota,A. and Sienkiewicz,M.
TITLE Association of Polymorphic Variants in Argonaute Genes with
Depression Risk in a Polish Population
JOURNAL Int J Mol Sci 23 (18), 10586 (2022)
PUBMED 36142498
REMARK GeneRIF: Association of Polymorphic Variants in Argonaute Genes
with Depression Risk in a Polish Population.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 13712)
AUTHORS O'Neill,A.C., Uzbas,F., Antognolli,G., Merino,F., Draganova,K.,
Jack,A., Zhang,S., Pedini,G., Schessner,J.P., Cramer,K.,
Schepers,A., Metzger,F., Esgleas,M., Smialowski,P., Guerrini,R.,
Falk,S., Feederle,R., Freytag,S., Wang,Z., Bahlo,M., Jungmann,R.,
Bagni,C., Borner,G.H.H., Robertson,S.P., Hauck,S.M. and Gotz,M.
TITLE Spatial centrosome proteome of human neural cells uncovers
disease-relevant heterogeneity
JOURNAL Science 376 (6599), eabf9088 (2022)
PUBMED 35709258
REFERENCE 4 (bases 1 to 13712)
AUTHORS Cho,N.H., Cheveralls,K.C., Brunner,A.D., Kim,K., Michaelis,A.C.,
Raghavan,P., Kobayashi,H., Savy,L., Li,J.Y., Canaj,H., Kim,J.Y.S.,
Stewart,E.M., Gnann,C., McCarthy,F., Cabrera,J.P., Brunetti,R.M.,
Chhun,B.B., Dingle,G., Hein,M.Y., Huang,B., Mehta,S.B.,
Weissman,J.S., Gomez-Sjoberg,R., Itzhak,D.N., Royer,L.A., Mann,M.
and Leonetti,M.D.
TITLE OpenCell: Endogenous tagging for the cartography of human cellular
organization
JOURNAL Science 375 (6585), eabi6983 (2022)
PUBMED 35271311
REFERENCE 5 (bases 1 to 13712)
AUTHORS Eswarappa,S.M., Potdar,A.A., Koch,W.J., Fan,Y., Vasu,K.,
Lindner,D., Willard,B., Graham,L.M., DiCorleto,P.E. and Fox,P.L.
TITLE Programmed translational readthrough generates antiangiogenic
VEGF-Ax
JOURNAL Cell 157 (7), 1605-1618 (2014)
PUBMED 24949972
REFERENCE 6 (bases 1 to 13712)
AUTHORS Carmell,M.A., Xuan,Z., Zhang,M.Q. and Hannon,G.J.
TITLE The Argonaute family: tentacles that reach into RNAi, developmental
control, stem cell maintenance, and tumorigenesis
JOURNAL Genes Dev 16 (21), 2733-2742 (2002)
PUBMED 12414724
REMARK Review article
REFERENCE 7 (bases 1 to 13712)
AUTHORS Martinez,J., Patkaniowska,A., Urlaub,H., Luhrmann,R. and Tuschl,T.
TITLE Single-stranded antisense siRNAs guide target RNA cleavage in RNAi
JOURNAL Cell 110 (5), 563-574 (2002)
PUBMED 12230974
REFERENCE 8 (bases 1 to 13712)
AUTHORS Beier,H. and Grimm,M.
TITLE Misreading of termination codons in eukaryotes by natural nonsense
suppressor tRNAs
JOURNAL Nucleic Acids Res 29 (23), 4767-4782 (2001)
PUBMED 11726686
REMARK Review article
REFERENCE 9 (bases 1 to 13712)
AUTHORS Koesters,R., Adams,V., Betts,D., Moos,R., Schmid,M., Siermann,A.,
Hassam,S., Weitz,S., Lichter,P., Heitz,P.U., von Knebel
Doeberitz,M. and Briner,J.
TITLE Human eukaryotic initiation factor EIF2C1 gene: cDNA sequence,
genomic organization, localization to chromosomal bands 1p34-p35,
and expression
JOURNAL Genomics 61 (2), 210-218 (1999)
PUBMED 10534406
REFERENCE 10 (bases 1 to 13712)
AUTHORS Reddy,P.H., Stockburger,E., Gillevet,P. and Tagle,D.A.
TITLE Mapping and characterization of novel (CAG)n repeat cDNAs from
adult human brain derived by the oligo capture method
JOURNAL Genomics 46 (2), 174-182 (1997)
PUBMED 9417904
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from HY052874.1, BC063275.1,
AK314148.1, AF093097.1, CR936823.1 and AL139286.13.
On Nov 23, 2018 this sequence version replaced NM_012199.4.
Summary: This gene encodes a member of the argonaute family of
proteins, which associate with small RNAs and have important roles
in RNA interference (RNAi) and RNA silencing. This protein binds to
microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses
translation of mRNAs that are complementary to them. It is also
involved in transcriptional gene silencing (TGS) of promoter
regions that are complementary to bound short antigene RNAs
(agRNAs), as well as in the degradation of miRNA-bound mRNA
targets. Alternatively spliced transcript variants encoding
different isoforms have been found for this gene. A recent study
showed this gene to be an authentic stop codon readthrough target,
and that its mRNA could give rise to an additional C-terminally
extended isoform by use of an alternative in-frame translation
termination codon. [provided by RefSeq, Nov 2015].
Transcript Variant: This variant (1) represents the predominant
transcript and encodes two isoforms, which result from the use of
alternative in-frame translation termination codons. The shorter
isoform (1) results from translation termination at the upstream
UGA stop codon, while the longer isoform (1x) results from UGA stop
codon readthrough to the downstream UAG termination codon. This
RefSeq represents the shorter isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF093097.1, BC063275.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA1965299, SAMEA1966682
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
MANE Ensembl match :: ENST00000373204.6/ ENSP00000362300.4
RefSeq Select criteria :: based on conservation, expression
##RefSeq-Attributes-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-6 HY052874.1 15-20
7-936 BC063275.1 1-930
937-2787 AK314148.1 912-2762
2788-7478 AF093097.1 2788-7478
7479-7479 CR936823.1 6081-6081
7480-13712 AL139286.13 67508-73740 c
FEATURES Location/Qualifiers
source 1..13712
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p34.3"
gene 1..13712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="argonaute RISC component 1"
/db_xref="GeneID:26523"
/db_xref="HGNC:HGNC:3262"
/db_xref="MIM:606228"
exon 1..238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 6
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978051547"
variation 9
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645056876"
variation 13
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175381189"
variation 14
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1287948787"
variation 18
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1488473859"
variation 19
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1220406709"
variation 20..45
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="ctcgcagtgggagctgctgcaggctc"
/db_xref="dbSNP:1244564144"
variation 20
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645057149"
variation 21
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489178234"
variation 22
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:745709197"
variation 23
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645057343"
variation 24
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571337067"
variation 25
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1379140477"
variation 27
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1442648369"
variation 28
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645057533"
variation 32
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1160937987"
variation 33
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955272510"
variation 35
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166868030"
variation 37
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571337095"
variation 38
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1321841535"
variation 39
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536512687"
variation 40
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571337106"
variation 44
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:960542884"
variation 45
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:988496009"
variation 46..49
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cgcg"
/replace="cgcgcg"
/db_xref="dbSNP:1330829239"
variation 46
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:796799611"
variation 47..57
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcggcggc"
/replace="gcggcggcggc"
/replace="gcggcggcggcggc"
/db_xref="dbSNP:879546980"
variation 47
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296078355"
variation 48
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645058154"
variation 49..81
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggcggcggc"
/replace="ggcggcggcaacggaggctgcgggggcggcggc"
/db_xref="dbSNP:1645058301"
variation 49
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1227464220"
variation 51
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:763454879"
variation 52
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323203976"
variation 54
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968367755"
variation 55
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1237075493"
variation 56..57
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gctgc"
/db_xref="dbSNP:1645058523"
variation 57
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978548875"
variation 58
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181076845"
variation 59
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239255916"
variation 62
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645058668"
variation 65
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867649714"
variation 68..80
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcgg"
/replace="gcgggggcggcgg"
/db_xref="dbSNP:921662839"
variation 69
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645058877"
variation 70
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:931863745"
variation 72..95
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggc"
/replace="gggcggcggcgcgagcggccgggc"
/db_xref="dbSNP:1645059013"
variation 75
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379985904"
variation 78
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:941176687"
variation 79
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398233997"
variation 81
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645059243"
variation 83
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645059390"
variation 85
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645059442"
variation 86
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1467201069"
variation 87
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1333289576"
variation 90
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645059570"
variation 91
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645059619"
variation 98
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645059665"
variation 99
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1336348406"
misc_feature 100..102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="upstream in-frame stop codon"
variation 101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1038631951"
variation 104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645059778"
variation 105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:918304981"
variation 106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645059864"
variation 109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645059915"
variation 112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645059958"
variation 113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645060009"
variation 115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1381028483"
variation 116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1256973986"
variation 120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:929736854"
variation 121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645060253"
variation 126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1045368943"
variation 127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:547802847"
variation 128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645060435"
variation 129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:906900125"
variation 132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1003735845"
variation 135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:569338309"
variation 136..140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gag"
/replace="gagag"
/db_xref="dbSNP:1645060711"
variation 137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645060739"
variation 138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:537033546"
variation 142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1239615580"
variation 143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148706022"
variation 144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571337241"
variation 145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571337258"
variation 147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645060959"
variation 148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055353380"
variation 150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645061351"
variation 151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645061389"
variation 155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895405324"
variation 156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011034611"
variation 159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193238281"
variation 162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645061557"
variation 163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:376952387"
variation 164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1478922696"
variation 165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:558415281"
variation 170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479948110"
variation 171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331202747"
variation 173..176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="caca"
/db_xref="dbSNP:754610928"
variation 174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:748181964"
variation 176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:767091091"
variation 178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167301864"
variation 179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1332063452"
variation 181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:374168686"
variation 182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415108216"
variation 183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645062143"
variation 184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426651719"
variation 187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277181222"
variation 188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022891969"
variation 189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571337349"
variation 191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:570480872"
variation 193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1365195293"
variation 194..198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="cctcc"
/db_xref="dbSNP:1645062511"
variation 194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:377185293"
variation 195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:369200771"
variation 198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:369830249"
variation 199..200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ta"
/db_xref="dbSNP:1645062720"
variation 199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1227307292"
variation 200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774749949"
variation 202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645062813"
variation 203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746274013"
variation 204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:999650573"
variation 205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312478731"
variation 206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571337398"
variation 207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771695172"
variation 210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645063088"
variation 211..213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1378065562"
CDS 214..2787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="isoform 1 is encoded by transcript variant 1; Golgi
Endoplasmic Reticulum protein 95 kDa; putative RNA-binding
protein Q99; protein argonaute-1; eIF2C 1; eIF-2C 1;
argonaute1; eukaryotic translation initiation factor 2C,
1; argonaute 1, RISC catalytic component; argonaute RISC
catalytic component 1"
/codon_start=1
/product="protein argonaute-1 isoform 1"
/protein_id="NP_036331.1"
/db_xref="CCDS:CCDS398.1"
/db_xref="GeneID:26523"
/db_xref="HGNC:HGNC:3262"
/db_xref="MIM:606228"
/translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 313..705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 733..885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 886..1248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(1042..1044,1087..1089,1129..1131,1141..1143,
1195..1197,1216..1218,1222..1224)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1138..1155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Interaction with guide RNA"
misc_feature 1381..2658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature 1777..1905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Interaction with guide RNA"
misc_feature order(1792..1794,1804..1806,1840..1851,1858..1860,
1882..1884,1891..1893,1903..1905,1915..1917)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1996..1998,2002..2004,2212..2214,2626..2628)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="active site"
/db_xref="CDD:240015"
misc_feature 2221..2238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Impairs access of bound RNA to the active site"
misc_feature 2335..2349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Interaction with guide RNA"
misc_feature 2464..2490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Interaction with guide RNA"
misc_feature 2575..2652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="propagated from UniProtKB/Swiss-Prot (Q9UL18.3);
Region: Interaction with guide RNA"
variation 220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291952738"
variation 221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775125489"
variation 227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219859778"
variation 228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645063342"
variation 229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:763615615"
variation 230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1228530087"
variation 231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776166589"
variation 233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761778204"
variation 234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571337459"
variation 235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645063687"
variation 237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765152517"
exon 239..422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:534382148"
variation 241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:12746607"
variation 242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:146814747"
variation 243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:972036410"
variation 245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:144077445"
variation 246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:140869088"
variation 247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170596078"
variation 248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645155622"
variation 255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1340212230"
variation 256..262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccccccc"
/replace="cccccccc"
/db_xref="dbSNP:752471592"
variation 258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645155750"
variation 259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206703390"
variation 260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:760951179"
variation 261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:202083240"
variation 262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557603507"
variation 263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148708759"
variation 264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:138410930"
variation 266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757285327"
variation 269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1022788713"
variation 270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1240989789"
variation 271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1446100175"
variation 272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571342863"
variation 273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:79428335"
variation 274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:75289061"
variation 275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645156392"
variation 276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:76388453"
variation 279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645156505"
variation 281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156570"
variation 284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156617"
variation 286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779432389"
variation 287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258716583"
variation 288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163754955"
variation 289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156991"
variation 290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1389168609"
variation 297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424891938"
variation 298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750911996"
variation 300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968257736"
variation 305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758952997"
variation 307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355653345"
variation 308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262459523"
variation 309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:574337653"
variation 313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645157658"
variation 315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179019303"
variation 316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1335156626"
variation 319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:747438396"
variation 321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1385353517"
variation 325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645157898"
variation 327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1418697160"
variation 334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179971147"
variation 335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:926553379"
variation 339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768283757"
variation 347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1297216732"
variation 349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:199891800"
variation 354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337673800"
variation 356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:868103064"
variation 361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146957455"
variation 363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:200988923"
variation 364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773153331"
variation 366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762965113"
variation 378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:143228790"
variation 388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1286109881"
variation 390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645158647"
variation 394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1347111293"
variation 395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448364494"
variation 396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:74665168"
variation 397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764307761"
variation 398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1042059854"
variation 400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645159128"
variation 401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645159199"
variation 408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321314626"
variation 412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:200676269"
variation 413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645159446"
variation 416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251930499"
variation 417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:564776109"
variation 419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194249910"
variation 420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:375999904"
exon 423..543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:755840915"
variation 429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039211966"
variation 438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645239978"
variation 439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777119725"
variation 446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1355230423"
variation 447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645240094"
variation 448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748876689"
variation 450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294130512"
variation 460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240210"
variation 462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770982492"
variation 475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774432228"
variation 476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745615692"
variation 486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240476"
variation 500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148710841"
variation 507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487074387"
variation 513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187568812"
variation 518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:368596181"
variation 520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373509253"
variation 521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:998200306"
variation 522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771782526"
variation 525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:775400690"
variation 529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645243206"
variation 537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761909595"
variation 538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371043471"
variation 542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:773265965"
exon 544..725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037229267"
variation 547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766471361"
variation 548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867858441"
variation 549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645251826"
variation 555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1479111626"
variation 556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251932"
variation 559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251969"
variation 561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:774463509"
variation 562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645252076"
variation 564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1306694761"
variation 568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606462"
variation 583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1327559774"
variation 591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759929800"
variation 600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645252397"
variation 601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606472"
variation 606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768140024"
variation 613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252575"
variation 616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974811600"
variation 629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748561732"
variation 632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:756518480"
variation 633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763796047"
variation 642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252872"
variation 643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645252917"
variation 645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140048484"
variation 646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406926679"
variation 648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:778531571"
variation 651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750019410"
variation 654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551846586"
variation 655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780052272"
variation 660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1295434292"
variation 661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1044509129"
variation 663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645253450"
variation 664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746713624"
variation 667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1356391187"
variation 670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645253604"
variation 671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768528277"
variation 672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:777924524"
variation 673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348951466"
variation 674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1225740432"
variation 678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146336392"
variation 682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398998653"
variation 684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771183369"
variation 685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645254066"
variation 686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774413049"
variation 688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275859576"
variation 689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275269608"
variation 693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254286"
variation 697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254328"
variation 699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000221753"
variation 703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759723959"
variation 706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298655751"
variation 707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645254551"
variation 708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204721590"
variation 711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250637242"
variation 712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481913947"
variation 715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200107860"
variation 720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772403603"
exon 726..862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757928895"
variation 733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148711333"
variation 735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339623786"
variation 741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935986859"
variation 742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:369913779"
variation 747..754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttct"
/replace="cttcttct"
/db_xref="dbSNP:1553154062"
variation 749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450839608"
variation 750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557606960"
variation 756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1216160432"
variation 758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196584082"
variation 759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:923359271"
variation 764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1243777480"
variation 765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1054485245"
variation 776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571348661"
variation 777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751539508"
variation 779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1553154069"
variation 780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:754921891"
variation 782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264815"
variation 786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264900"
variation 789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571348686"
variation 794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388452609"
variation 795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265183"
variation 796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711374"
variation 797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780934730"
variation 800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:745945344"
variation 804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148711380"
variation 808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711383"
variation 816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390406046"
variation 821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645265474"
variation 827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1385468503"
variation 835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557607042"
variation 857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415969084"
variation 858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320779237"
variation 861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265786"
exon 863..997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11806527"
variation 870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:11811275"
variation 880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:751072190"
variation 881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281040808"
variation 882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645271909"
variation 888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299243666"
variation 893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754906190"
variation 894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2296470"
variation 899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645272259"
variation 904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571349090"
variation 907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266180488"
variation 908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372933409"
variation 911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1204384593"
variation 913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255631567"
variation 915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:201138355"
variation 918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184303864"
variation 925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645272758"
variation 927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1364687783"
variation 932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778966083"
variation 933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645272959"
variation 937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:17855789"
variation 939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758584590"
variation 942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362228512"
variation 946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273227"
variation 948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010672520"
variation 952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1422475379"
variation 954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645273440"
variation 955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018151324"
variation 957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273614"
variation 959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470621142"
variation 960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780175783"
variation 961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400919651"
variation 965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273887"
variation 971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645273962"
variation 972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747113992"
variation 973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645274152"
variation 978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769226315"
variation 987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350821626"
exon 998..1085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:770562881"
variation 999..1000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:34232554"
variation 1000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278321"
variation 1005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278406"
variation 1010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:773882882"
variation 1014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191695845"
variation 1017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1428675136"
variation 1020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1166366490"
variation 1028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278705"
variation 1031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759010563"
variation 1044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372555392"
variation 1045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278907"
variation 1047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759416843"
variation 1048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533050841"
variation 1050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292791760"
variation 1052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711775"
variation 1054..1055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148711782"
variation 1054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1162477236"
variation 1056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760596663"
variation 1059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551240186"
variation 1060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571349540"
variation 1062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570547124"
variation 1063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279527"
variation 1066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279588"
variation 1068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349563"
variation 1069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349566"
variation 1071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1364584684"
variation 1072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:761517181"
variation 1075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645279945"
variation 1085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294234936"
exon 1086..1233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1086..1141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="att"
/replace="attccccttacagctggagagtggacagactgtggagtgcacagtggc
acagtatt"
/db_xref="dbSNP:1557608209"
variation 1086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753991581"
variation 1089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645296230"
variation 1091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1295256848"
variation 1092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:189586551"
variation 1103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051022486"
variation 1107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238748148"
variation 1115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472903106"
variation 1116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:372979737"
variation 1120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148712287"
variation 1124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296616"
variation 1126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1306020581"
variation 1131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296748"
variation 1136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296815"
variation 1146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050283350"
variation 1155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546553880"
variation 1156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420666776"
variation 1161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645297028"
variation 1166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757631001"
variation 1176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909137877"
variation 1177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411142617"
variation 1182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645297285"
variation 1188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756155452"
variation 1189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338758069"
variation 1200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645297454"
variation 1204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759454083"
variation 1212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359860901"
variation 1221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447524690"
variation 1224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778306053"
variation 1227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149082767"
variation 1228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:151208943"
exon 1234..1353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275974433"
variation 1240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715329"
variation 1242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:775889960"
variation 1243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200563862"
variation 1244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612017"
variation 1249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415960544"
variation 1255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:764062753"
variation 1257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050570393"
variation 1258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908985871"
variation 1259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715349"
variation 1263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416045"
variation 1268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1343816827"
variation 1269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753994302"
variation 1277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278173586"
variation 1278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757689155"
variation 1283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416400"
variation 1284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416455"
variation 1292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416507"
variation 1293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:199616208"
variation 1296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1200825557"
variation 1320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758791735"
variation 1324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715372"
variation 1329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779631833"
variation 1332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416806"
variation 1334..1341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggag"
/replace="aggaggag"
/db_xref="dbSNP:2148715376"
variation 1336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:762638025"
variation 1338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746619529"
variation 1340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1430592479"
variation 1344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168233985"
variation 1346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1369030058"
variation 1348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754699172"
variation 1350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274129921"
variation 1351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780563736"
exon 1354..1476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750947963"
variation 1360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1404044449"
variation 1361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715571"
variation 1364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715573"
variation 1367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320886676"
variation 1370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645424335"
variation 1371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424415"
variation 1373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148715578"
variation 1374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424467"
variation 1381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424528"
variation 1382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758951181"
variation 1386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72661614"
variation 1389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1296302699"
variation 1392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:752028013"
variation 1395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002104589"
variation 1398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:868287969"
variation 1401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754573452"
variation 1404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328358090"
variation 1407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542457159"
variation 1412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284524734"
variation 1415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780911842"
variation 1416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425246"
variation 1417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1226472292"
variation 1420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557612417"
variation 1421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425404"
variation 1423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645425456"
variation 1424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425501"
variation 1425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:747545727"
variation 1430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715621"
variation 1432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:755717690"
variation 1433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425695"
variation 1438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1208181934"
variation 1443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645425811"
variation 1447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571357990"
variation 1448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376308772"
variation 1449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:377394072"
variation 1451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544024909"
variation 1452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142094247"
variation 1456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1472015606"
variation 1458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161925549"
variation 1467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:745684571"
variation 1470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:61751003"
variation 1471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:893311782"
variation 1473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645426498"
variation 1474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935068063"
variation 1475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645426594"
exon 1477..1610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645430270"
variation 1480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779760591"
variation 1481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258906885"
variation 1482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645430440"
variation 1485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748337975"
variation 1486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1428424991"
variation 1493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015543488"
variation 1497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:199936275"
variation 1503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773266381"
variation 1509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:763034859"
variation 1510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432427531"
variation 1515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:771277669"
variation 1516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170126627"
variation 1517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645431243"
variation 1519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148715842"
variation 1521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715846"
variation 1522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431327"
variation 1523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370865156"
variation 1524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774954734"
variation 1527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431506"
variation 1530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759771963"
variation 1533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369633288"
variation 1537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431703"
variation 1538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387317470"
variation 1542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571358401"
variation 1544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313546401"
variation 1548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1300648006"
variation 1553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:371917876"
variation 1555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368914800"
variation 1557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612737"
variation 1564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753155364"
variation 1566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760403306"
variation 1571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645432313"
variation 1572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:375102195"
variation 1575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645432435"
variation 1576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1262161642"
variation 1577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:753328428"
variation 1584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919044941"
variation 1595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203451050"
variation 1606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:569514136"
variation 1608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023867293"
exon 1611..1795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199479145"
variation 1620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645532937"
variation 1623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645533022"
variation 1626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945694295"
variation 1630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:775988217"
variation 1631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761121371"
variation 1632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645533275"
variation 1637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12739932"
variation 1647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763795877"
variation 1649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148718885"
variation 1650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184426040"
variation 1657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415613590"
variation 1660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557615824"
variation 1671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776441734"
variation 1674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769789947"
variation 1675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163885953"
variation 1689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040031325"
variation 1692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:12735795"
variation 1694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:12735796"
variation 1695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:368806171"
variation 1699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167063899"
variation 1705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645534232"
variation 1707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458793259"
variation 1708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998417309"
variation 1713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340285630"
variation 1716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148718923"
variation 1717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1421049999"
variation 1718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645534556"
variation 1720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:201120683"
variation 1721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645534737"
variation 1722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1466906554"
variation 1723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006126627"
variation 1724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1321275499"
variation 1725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:764770945"
variation 1728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:749967453"
variation 1731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758341990"
variation 1733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341527708"
variation 1738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380272290"
variation 1739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143395835"
variation 1740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751289476"
variation 1742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:200447801"
variation 1743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754799646"
variation 1744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645535695"
variation 1746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1050019769"
variation 1752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371346774"
variation 1756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268149326"
variation 1763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645536021"
variation 1767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1401160206"
variation 1776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645536136"
variation 1785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749491572"
variation 1788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757463904"
exon 1796..1955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645685994"
variation 1807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385910631"
variation 1808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:758585726"
variation 1810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686189"
variation 1812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780324190"
variation 1821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686375"
variation 1824
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723061"
variation 1827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:747499045"
variation 1838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769346828"
variation 1839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:199790587"
variation 1848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225197236"
variation 1852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301736040"
variation 1853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265127399"
variation 1854..1855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645686932"
variation 1855..1856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggaacacaataatgac"
/db_xref="dbSNP:1645687001"
variation 1860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:141975081"
variation 1861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769429758"
variation 1862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687220"
variation 1864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300821067"
variation 1865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571373923"
variation 1866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888769037"
variation 1872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687499"
variation 1875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645687560"
variation 1876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645687616"
variation 1883..1886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1645687661"
variation 1885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343928483"
variation 1890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723097"
variation 1894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645687783"
variation 1899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205604565"
variation 1911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139495925"
variation 1918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688251"
variation 1923
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1038775292"
variation 1927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432507106"
variation 1936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762483320"
variation 1941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778368573"
variation 1944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1223700131"
variation 1947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247322617"
variation 1954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688704"
exon 1956..2046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164256024"
variation 1962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770625415"
variation 1963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528425591"
variation 1965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645692834"
variation 1971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:771935455"
variation 1986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775325449"
variation 1987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693020"
variation 1995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557621093"
variation 1998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:547329659"
variation 1999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645693235"
variation 2004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:753726639"
variation 2005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693386"
variation 2007..2012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:35257283"
variation 2007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324407912"
variation 2009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557621129"
variation 2010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150639776"
variation 2011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1284611497"
variation 2013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149707892"
variation 2015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723245"
variation 2016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:751632923"
variation 2025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1270050276"
variation 2028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568739814"
variation 2033..2037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:551219785"
variation 2036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1353927503"
variation 2037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645694220"
variation 2038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201807040"
variation 2040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1460339268"
variation 2043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748183477"
variation 2044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756692838"
exon 2047..2241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397084516"
variation 2051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:981999787"
variation 2058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390797463"
variation 2060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756572252"
variation 2063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754140760"
variation 2064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757637094"
variation 2065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779294804"
variation 2066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:745501471"
variation 2069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:72661618"
variation 2071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715386"
variation 2074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715448"
variation 2075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715524"
variation 2078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715568"
variation 2082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455593427"
variation 2089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779428711"
variation 2095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746534916"
variation 2096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571375783"
variation 2099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571375789"
variation 2103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348772102"
variation 2105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715985"
variation 2106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776733250"
variation 2107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177037855"
variation 2109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148723911"
variation 2110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747913193"
variation 2112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1251138878"
variation 2119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548570122"
variation 2121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769680596"
variation 2134..2156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcctacatggtgcgtgagctcct"
/replace="tcctacatggtgcgtgagctcctacatggtgcgtgagctcct"
/db_xref="dbSNP:1553156567"
variation 2136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:148568098"
variation 2140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:759663700"
variation 2144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767845424"
variation 2146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645716713"
variation 2147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452226490"
variation 2151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645716848"
variation 2152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1170223877"
variation 2154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775362502"
variation 2157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461384946"
variation 2160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1296384917"
variation 2163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:575591328"
variation 2172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764455703"
variation 2174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645717324"
variation 2175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754370001"
variation 2179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723971"
variation 2180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1369025845"
variation 2191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762360695"
variation 2192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296692574"
variation 2193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:147571046"
variation 2194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:750855900"
variation 2196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723986"
variation 2197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757924485"
variation 2199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779770428"
variation 2200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267744084"
variation 2202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1165442477"
variation 2203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:750985823"
variation 2209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1213741177"
variation 2210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754547764"
variation 2211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466822711"
variation 2212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645718693"
variation 2217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190144851"
variation 2218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1262080535"
variation 2220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780890292"
variation 2222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12564106"
variation 2228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769908492"
variation 2235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645719049"
variation 2238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645719104"
exon 2242..2376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttttttt"
/db_xref="dbSNP:1414634162"
variation 2247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756047129"
variation 2249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565958096"
variation 2250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758202"
variation 2252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1224957910"
variation 2255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:896742034"
variation 2257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307134258"
variation 2259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:748984548"
variation 2260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:143104504"
variation 2268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645758583"
variation 2271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282114791"
variation 2277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778610016"
variation 2280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758802"
variation 2283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209966112"
variation 2291..2294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148725180"
variation 2295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645758944"
variation 2301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:7512720"
variation 2310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020631361"
variation 2311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557623594"
variation 2319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768936737"
variation 2323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142277966"
variation 2325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:138262926"
variation 2326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645759563"
variation 2334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770238895"
variation 2335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725216"
variation 2336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773801844"
variation 2340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763410885"
variation 2350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766745148"
variation 2357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1311510365"
variation 2366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774636073"
variation 2374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557623659"
variation 2375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645760176"
variation 2376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759256057"
exon 2377..2478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439738572"
variation 2384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373512212"
variation 2394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759990630"
variation 2396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160280075"
variation 2403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767227187"
variation 2408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772040"
variation 2410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1272181556"
variation 2412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1305762819"
variation 2413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645772202"
variation 2414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015522007"
variation 2415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394089472"
variation 2419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438949295"
variation 2420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328128014"
variation 2422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1371847135"
variation 2423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775311574"
variation 2425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:962129831"
variation 2433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278891860"
variation 2434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772715"
variation 2436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:760440138"
variation 2442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763635186"
variation 2453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645772906"
variation 2455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191993432"
variation 2457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:370393930"
variation 2460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757155977"
variation 2465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148725560"
variation 2466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765103292"
variation 2467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750172296"
variation 2469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423532922"
exon 2479..2678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761255422"
variation 2498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557624574"
variation 2502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765183489"
variation 2504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750331557"
variation 2514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396473268"
variation 2517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762926752"
variation 2518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400980541"
variation 2520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309729088"
variation 2522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351503366"
variation 2524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766150388"
variation 2525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371456175"
variation 2526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1416482791"
variation 2532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293818805"
variation 2535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148725983"
variation 2538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756293606"
variation 2541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777869344"
variation 2547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:753905238"
variation 2550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1351616919"
variation 2555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725999"
variation 2556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766341150"
variation 2559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282516031"
variation 2560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571380407"
variation 2562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779087158"
variation 2564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787177"
variation 2577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746352418"
variation 2578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:144290045"
variation 2581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1316031798"
variation 2589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009486066"
variation 2592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253810168"
variation 2602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726029"
variation 2604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780502108"
variation 2608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645787653"
variation 2619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139104482"
variation 2626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1257568536"
variation 2627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1365053413"
variation 2628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768309604"
variation 2631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787971"
variation 2634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645788028"
variation 2637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:781573871"
variation 2641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157651125"
variation 2642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557624739"
variation 2646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425163970"
variation 2648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867363147"
variation 2649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645788386"
variation 2656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776181658"
variation 2658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1372029994"
variation 2664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1436350986"
variation 2670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571380526"
variation 2671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1318627286"
variation 2676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645788766"
exon 2679..13712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571380871"
variation 2695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200112017"
variation 2699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747745215"
variation 2700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537312381"
variation 2708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:772641687"
variation 2712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645794818"
variation 2717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1230155462"
variation 2718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645794950"
variation 2729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252403207"
variation 2730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1339352983"
variation 2736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:748808273"
variation 2742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367549238"
variation 2743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314564307"
variation 2746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:774302590"
variation 2749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759554925"
variation 2764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:371427797"
variation 2770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009951542"
variation 2772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:778473881"
variation 2781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:764523718"
variation 2782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775410850"
variation 2784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:761934070"
variation 2790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765573016"
variation 2796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:750483408"
variation 2797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645796023"
variation 2798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796066"
variation 2801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:758585810"
variation 2805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766609131"
variation 2806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1325491422"
variation 2807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1365840620"
variation 2809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751988702"
variation 2812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:755567551"
variation 2816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415466187"
variation 2820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645796465"
variation 2822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399336214"
variation 2828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796571"
variation 2832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:376748083"
variation 2833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217374400"
variation 2835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343703234"
variation 2837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748552081"
variation 2843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:965243292"
variation 2844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745575440"
variation 2846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438723139"
variation 2848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645796975"
variation 2849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:558595376"
variation 2857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1369626433"
variation 2865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797129"
variation 2871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219639480"
variation 2874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645797215"
variation 2877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797274"
variation 2882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381154"
variation 2883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797336"
misc_feature 2887..2889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="alternative translation termination codon, use of
which results in the longer, C-terminally extended isoform
1x"
variation 2887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381165"
variation 2891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797421"
variation 2897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797468"
variation 2899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1321542247"
variation 2900..2916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggatgccttgtttcct"
/replace="aggatgccttgtttcctaaggatgccttgtttcct"
/db_xref="dbSNP:1645797586"
variation 2901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283260848"
variation 2902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797684"
variation 2905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797727"
variation 2909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:953916295"
variation 2910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797820"
variation 2913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645797860"
variation 2914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381191"
variation 2915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381199"
variation 2917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645798304"
variation 2918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314872898"
variation 2920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:983883552"
variation 2925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:879239347"
variation 2926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645798493"
variation 2928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:150023314"
variation 2930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381230"
variation 2931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909582929"
variation 2932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1025410190"
variation 2937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759347470"
variation 2938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381248"
variation 2939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211269541"
variation 2940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485412027"
variation 2946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:972780830"
variation 2957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645799010"
variation 2958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1478628272"
variation 2963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:372514513"
variation 2970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1406280799"
variation 2977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799213"
variation 2978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645799270"
variation 2985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645799367"
variation 2985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184496486"
variation 2987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1031125362"
variation 2995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160196944"
variation 2998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799508"
variation 2999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:958110614"
variation 3000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:949596040"
variation 3003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1263585743"
variation 3004..3007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645799907"
variation 3004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:989617377"
variation 3007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351587097"
variation 3008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982388540"
variation 3009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645800054"
variation 3010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381367"
variation 3011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381375"
variation 3013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278837312"
variation 3015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348418143"
variation 3023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:541172177"
variation 3033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381393"
variation 3036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645800369"
variation 3038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:202115790"
variation 3040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288662217"
variation 3042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800533"
variation 3045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800586"
variation 3046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381418"
variation 3047..3048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:878964846"
variation 3053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:911352318"
variation 3058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426560286"
variation 3060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181957464"
variation 3069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645800907"
variation 3071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645800952"
variation 3076..3082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acaca"
/replace="acacaca"
/db_xref="dbSNP:977058838"
variation 3080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922824952"
variation 3084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726405"
variation 3086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360308850"
variation 3091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801187"
variation 3092..3105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtgactcacagtg"
/db_xref="dbSNP:1645801236"
variation 3093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183336786"
variation 3097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938140807"
variation 3101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187653963"
variation 3102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571381510"
variation 3103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801465"
variation 3106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1474331605"
variation 3108..3110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148726435"
variation 3108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541984369"
variation 3112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:563307920"
variation 3119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400788229"
variation 3122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530845732"
variation 3124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801740"
variation 3130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:545735322"
variation 3131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042351647"
variation 3134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411490768"
variation 3136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645801948"
variation 3140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801989"
variation 3141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760505499"
variation 3146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343689135"
variation 3150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055654359"
variation 3151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802314"
variation 3156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901211923"
variation 3159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1225506641"
variation 3163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894285520"
variation 3164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802528"
variation 3167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285541494"
variation 3168..3169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645802682"
variation 3168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802635"
variation 3174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381598"
variation 3177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726466"
variation 3180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645802788"
variation 3182..3193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gat"
/replace="gatactttagat"
/db_xref="dbSNP:1645802823"
variation 3189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1644547952"
variation 3191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645802872"
variation 3194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645802921"
variation 3197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564987081"
variation 3199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949852940"
variation 3211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213406425"
variation 3212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1273180555"
variation 3214..3216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645803165"
variation 3219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045673538"
variation 3220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206364733"
variation 3221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645803305"
variation 3222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:903096962"
variation 3223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484869602"
variation 3224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998051016"
variation 3228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645803490"
variation 3230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190778316"
variation 3231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028235058"
variation 3235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:573515805"
variation 3238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:999569691"
variation 3259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166214313"
variation 3260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726515"
variation 3262..3269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggactag"
/db_xref="dbSNP:542709440"
variation 3264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889712007"
variation 3271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645803888"
variation 3272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169098660"
variation 3277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645804021"
variation 3278..3285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaa"
/replace="aagaagaa"
/db_xref="dbSNP:1645804185"
variation 3278..3279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:763151419"
variation 3283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804239"
variation 3288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804313"
variation 3291..3293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1645804382"
variation 3300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804429"
variation 3303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005763656"
variation 3304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804548"
variation 3306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1335784510"
variation 3308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016780880"
variation 3309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804829"
variation 3311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010924348"
variation 3317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:116130930"
variation 3319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625376"
variation 3321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294728825"
variation 3322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805224"
variation 3324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:972530050"
variation 3325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977320190"
variation 3326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381730"
variation 3327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023962631"
variation 3333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:16822444"
variation 3336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645805569"
variation 3355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202542245"
variation 3360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645805687"
variation 3362..3367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1481124682"
variation 3368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1446614001"
variation 3370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805834"
variation 3373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979769602"
variation 3382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982470959"
variation 3384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:926829253"
variation 3385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806069"
variation 3387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406617402"
variation 3390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1450110270"
variation 3391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806451"
variation 3393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645806516"
variation 3395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181016113"
variation 3397..3408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="ccaccccccacc"
/db_xref="dbSNP:1645806646"
variation 3400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:751161957"
variation 3402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157587098"
variation 3403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2057606"
variation 3404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402522809"
variation 3405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766433433"
variation 3411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807023"
variation 3413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645807088"
variation 3415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726602"
variation 3421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726604"
variation 3423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:915647003"
variation 3425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774454425"
variation 3427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420740074"
variation 3430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303406314"
variation 3431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807432"
variation 3433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645807482"
variation 3436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645807546"
variation 3437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807607"
variation 3438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807682"
variation 3440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807739"
variation 3442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329847234"
variation 3444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807828"
variation 3450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945440601"
variation 3454..3460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcc"
/replace="ctcctcc"
/db_xref="dbSNP:1235948754"
variation 3457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275775510"
variation 3458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1350357017"
variation 3459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808081"
variation 3461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645808119"
variation 3464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645808158"
variation 3465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949953054"
variation 3466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045968353"
variation 3471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759722423"
variation 3475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645808328"
variation 3478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570108958"
variation 3479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1266648467"
variation 3483..3492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taatacttaa"
/db_xref="dbSNP:1645808475"
variation 3489..3491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttatta"
/db_xref="dbSNP:1431340111"
variation 3489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302778723"
variation 3494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042485212"
variation 3497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378011808"
variation 3499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645808743"
variation 3500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808782"
variation 3502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1322040566"
variation 3523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363876827"
variation 3524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767682331"
variation 3526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148726670"
variation 3530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390382219"
variation 3532..3540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttcc"
/replace="cttccttcc"
/db_xref="dbSNP:934536365"
variation 3534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645809082"
variation 3535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1324604644"
variation 3539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:369176195"
variation 3540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933953211"
variation 3541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275467706"
variation 3543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726687"
variation 3544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:544835378"
variation 3545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226871979"
variation 3547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645809561"
variation 3553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645809599"
variation 3557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645809645"
variation 3558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1290514635"
variation 3559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756407221"
variation 3568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1309107602"
variation 3575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018350753"
variation 3576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:777135778"
variation 3577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810043"
variation 3578..3581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taat"
/replace="taataat"
/db_xref="dbSNP:767987739"
variation 3578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810115"
variation 3588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1005485340"
variation 3592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810360"
variation 3597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267896119"
variation 3598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810475"
variation 3599..3602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:899918123"
variation 3599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998372574"
variation 3600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810616"
variation 3602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413786257"
variation 3603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810706"
variation 3604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017159938"
variation 3607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:897013046"
variation 3612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810809"
variation 3613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:993907860"
variation 3617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810891"
variation 3618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372299339"
variation 3620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1030205426"
variation 3621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1490719297"
variation 3624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811096"
variation 3625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366224993"
variation 3626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:764601080"
variation 3627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:983409479"
variation 3629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811328"
variation 3630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811390"
variation 3631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645811438"
variation 3641..3646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggtag"
/db_xref="dbSNP:756900274"
variation 3643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564719281"
variation 3646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263836"
variation 3647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726754"
variation 3650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310206743"
variation 3651..3663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ggaagaaataccc"
/db_xref="dbSNP:1645811737"
variation 3652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811799"
variation 3655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868386416"
variation 3657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1351444886"
variation 3660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571382102"
variation 3661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414421664"
variation 3664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382775879"
variation 3666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645812125"
variation 3681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537751988"
variation 3683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310777089"
variation 3684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812276"
variation 3686..3691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agaaag"
/db_xref="dbSNP:1323589881"
variation 3690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812383"
variation 3691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440689421"
variation 3693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812500"
variation 3696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559288688"
variation 3704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812623"
variation 3705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163258781"
variation 3712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812827"
variation 3715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991151309"
variation 3716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812964"
variation 3723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813038"
variation 3732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979737204"
variation 3733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813196"
variation 3743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813267"
variation 3744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813358"
variation 3746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813438"
variation 3749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813486"
variation 3752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813558"
variation 3754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253742631"
variation 3758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1426728596"
variation 3762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:570501842"
variation 3776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645813750"
variation 3780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180935385"
variation 3781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253558654"
variation 3783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726822"
variation 3786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425105622"
variation 3794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645814149"
variation 3797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324508934"
variation 3799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:2148726831"
variation 3801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814267"
variation 3805..3808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctc"
/replace="tctctc"
/db_xref="dbSNP:1645814366"
variation 3805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1034039916"
variation 3806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:959872642"
variation 3808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353978258"
variation 3809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:915698048"
variation 3810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:989776856"
variation 3813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645814620"
variation 3820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:757779782"
variation 3825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814719"
variation 3826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726853"
variation 3829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440196918"
variation 3831..3838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctggcct"
/replace="cctggcctggcct"
/db_xref="dbSNP:1645814975"
variation 3831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1299799751"
variation 3833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645815037"
variation 3834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382230"
variation 3840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815140"
variation 3843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726863"
variation 3847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645815205"
variation 3848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:534583086"
variation 3849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381602990"
variation 3850..3873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctccttttctccttattcctcct"
/replace="cctccttttctccttattcctccttttctccttattcctcct"
/db_xref="dbSNP:1553157181"
variation 3853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396729640"
variation 3861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294910497"
variation 3862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815599"
variation 3865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726875"
variation 3866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363066192"
variation 3869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815689"
variation 3872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1226112037"
variation 3874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:981302878"
variation 3876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815832"
variation 3878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342612616"
variation 3880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778328049"
variation 3881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:745361943"
variation 3883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816080"
variation 3885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312596434"
variation 3886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816207"
variation 3889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645816260"
variation 3896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726894"
variation 3897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816341"
variation 3898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726901"
variation 3904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934611109"
variation 3905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816494"
variation 3908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1361359690"
variation 3909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816630"
variation 3912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182044331"
variation 3913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816747"
variation 3915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1246905719"
variation 3921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:922654018"
variation 3922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1228516462"
variation 3924..3925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:377610395"
variation 3930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:780857425"
variation 3935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414319373"
variation 3938..3940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:546902781"
variation 3938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206085009"
variation 3940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466769406"
variation 3946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817287"
variation 3947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320079218"
variation 3950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817432"
variation 3951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726946"
variation 3952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817503"
variation 3953..3957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1645817555"
variation 3954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817611"
variation 3955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914485906"
variation 3956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11544095"
variation 3958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645817850"
variation 3959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645817948"
variation 3959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039642957"
variation 3960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:911246481"
variation 3965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818052"
variation 3966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818125"
variation 3967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218478003"
variation 3969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1383747021"
variation 3972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818278"
variation 3979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1474000510"
variation 3982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544171570"
variation 3983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645818496"
variation 3984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645818573"
variation 3987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210403066"
variation 3989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267025830"
variation 3991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818774"
variation 3992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941259690"
variation 3993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210045144"
variation 4001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625954"
variation 4002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998653464"
variation 4007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726995"
variation 4011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419147558"
variation 4012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051283965"
variation 4016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645819124"
variation 4021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574493933"
variation 4022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819228"
variation 4024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819305"
variation 4025..4031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/replace="agagaga"
/db_xref="dbSNP:1408443115"
variation 4025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541523978"
variation 4026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819519"
variation 4031..4039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaacaaaa"
/db_xref="dbSNP:1645819640"
variation 4031..4034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148727018"
variation 4031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1158708063"
variation 4036..4039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaaa"
/db_xref="dbSNP:1410026095"
variation 4037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819731"
variation 4040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819774"
variation 4041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896976019"
variation 4044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172827157"
variation 4050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1401165263"
variation 4051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819984"
variation 4055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1451767701"
variation 4056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820089"
variation 4059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645820124"
variation 4060..4061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1345756099"
variation 4065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334655869"
variation 4066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004367048"
variation 4068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219582033"
variation 4073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287397808"
variation 4078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645820515"
variation 4082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:372998612"
variation 4085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017237893"
variation 4088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820656"
variation 4092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:373319406"
variation 4094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645820760"
variation 4095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229745842"
variation 4096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1268251248"
variation 4102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645820953"
variation 4103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821031"
variation 4105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821074"
variation 4106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727056"
variation 4114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:993969649"
variation 4120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012596617"
variation 4122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645821231"
variation 4123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448552286"
variation 4126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045604964"
variation 4127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906930863"
variation 4129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821420"
variation 4132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821491"
variation 4140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489048022"
variation 4155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727077"
variation 4156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645821607"
variation 4157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1181892531"
variation 4163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557125243"
variation 4166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821728"
variation 4168..4169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645821768"
variation 4169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001311726"
variation 4170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473677704"
variation 4181..4185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1645822036"
variation 4182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034417264"
variation 4184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822170"
variation 4185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413184561"
variation 4186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382638"
variation 4189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382641"
variation 4193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:957094857"
variation 4194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011572868"
variation 4198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645822564"
variation 4199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822629"
variation 4200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971191188"
variation 4202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022507355"
variation 4204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727119"
variation 4206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756144267"
variation 4207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645822899"
variation 4213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822953"
variation 4217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575345163"
variation 4220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978201284"
variation 4222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626132"
variation 4224..4225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645823176"
variation 4225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411307035"
variation 4230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322270306"
variation 4231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727135"
variation 4237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:924373359"
variation 4238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203565985"
variation 4242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922791500"
variation 4248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645823580"
variation 4251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823649"
variation 4252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727146"
variation 4253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546120621"
variation 4254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645823762"
variation 4257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823818"
variation 4259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1444486087"
variation 4261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1204943412"
variation 4263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:564025142"
variation 4265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727163"
variation 4266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376079873"
variation 4268..4284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcact"
/replace="ctgcactgtcctgcact"
/db_xref="dbSNP:1645824056"
variation 4269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824109"
variation 4270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1250105760"
variation 4273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:989931107"
variation 4278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824277"
variation 4280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183169742"
variation 4281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824454"
variation 4283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824508"
variation 4295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645824577"
variation 4298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237116217"
variation 4303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471885737"
variation 4312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780741067"
variation 4313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727183"
variation 4316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:576855548"
variation 4319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645824874"
variation 4322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541050685"
variation 4324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727191"
variation 4333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1425259445"
variation 4334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1196156313"
variation 4336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424382195"
variation 4338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431327702"
variation 4339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329204468"
variation 4353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148727201"
variation 4355..4360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtgt"
/replace="gtgtgt"
/db_xref="dbSNP:1645825345"
variation 4355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:943249793"
variation 4364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749624548"
variation 4366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825509"
variation 4368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:921234759"
variation 4376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645825620"
variation 4379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382858"
variation 4386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645825732"
variation 4389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382833814"
variation 4397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933993252"
variation 4398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825989"
variation 4402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645826036"
variation 4404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826076"
variation 4407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1344840620"
variation 4409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1291821976"
variation 4409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727232"
variation 4414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727237"
variation 4417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826237"
variation 4418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206299477"
variation 4419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051641159"
variation 4429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645826361"
variation 4442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440880750"
variation 4443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:559288072"
variation 4450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1404346706"
variation 4451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826631"
variation 4452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826690"
variation 4454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238149641"
variation 4457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645826756"
variation 4458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571382930"
variation 4459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1414972830"
variation 4460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645826919"
variation 4462..4463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645827004"
variation 4462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382944"
variation 4463..4464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645827093"
variation 4463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199589770"
variation 4464..4483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/replace="ttttttttttttt"
/replace="tttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttttt"
/db_xref="dbSNP:rs34158936"
variation 4464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1317317471"
variation 4474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827510"
variation 4478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827572"
variation 4481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645827616"
variation 4482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645827660"
variation 4483..4484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/replace="ttttttttttttttg"
/db_xref="dbSNP:1645827744"
variation 4483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433708088"
variation 4484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1324502726"
variation 4484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645827857"
variation 4484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:78160010"
variation 4485..4487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148727293"
variation 4486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:80323450"
variation 4488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttttttat"
/db_xref="dbSNP:1344308844"
variation 4489..4499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagacatgggg"
/db_xref="dbSNP:1571383009"
variation 4489..4494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagaca"
/db_xref="dbSNP:1645828118"
variation 4489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1221227537"
variation 4490..4491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttt"
/db_xref="dbSNP:1571383021"
variation 4490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264465139"
variation 4491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828282"
variation 4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1347685404"
variation 4494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1246135635"
variation 4496..4499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggg"
/db_xref="dbSNP:1201553074"
variation 4499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383053"
variation 4500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571383061"
variation 4503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202415337"
variation 4505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1446323086"
variation 4507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828685"
variation 4509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828732"
variation 4510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828797"
variation 4511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828866"
variation 4513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645828904"
variation 4514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828946"
variation 4515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038777167"
variation 4517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645829095"
variation 4518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206886008"
variation 4520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:887198165"
variation 4522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383099"
variation 4524..4525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1246165335"
variation 4527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1466173006"
variation 4528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727341"
variation 4529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004418882"
variation 4530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645829765"
variation 4531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727347"
variation 4532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283953973"
variation 4533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376878725"
variation 4535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:185636267"
variation 4540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645830052"
variation 4540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038514020"
variation 4541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548345110"
variation 4547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645830216"
variation 4550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429539161"
variation 4555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:141020163"
variation 4557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317924229"
variation 4566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045574832"
variation 4567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390154190"
variation 4570..4575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccccc"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:1264240367"
variation 4570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:907066780"
variation 4573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:531001823"
variation 4574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1235875938"
variation 4576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645830802"
variation 4576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1480146316"
variation 4578..4580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1571383214"
variation 4578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645830860"
variation 4582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001277575"
variation 4586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197277733"
variation 4587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379454699"
variation 4588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022652520"
variation 4590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157971224"
variation 4591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1382485104"
variation 4592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:971502052"
variation 4593..4595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1205659617"
variation 4594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1298430299"
variation 4595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552938102"
variation 4596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645831457"
variation 4597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1266582286"
variation 4598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645831573"
variation 4599..4605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttttttt"
/db_xref="dbSNP:1364497161"
variation 4605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645831800"
variation 4610..4613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645831867"
variation 4612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002538732"
variation 4614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031870725"
variation 4615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472079739"
variation 4617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955779820"
variation 4622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302700761"
variation 4628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383330"
variation 4629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832314"
variation 4633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832379"
variation 4637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:3767701"
variation 4638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832571"
variation 4639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727431"
variation 4643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832655"
variation 4646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413552657"
variation 4648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1453774936"
variation 4651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163253086"
variation 4657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:535305390"
variation 4658..4660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttt"
/db_xref="dbSNP:1645833042"
variation 4660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1388934119"
variation 4661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:546631807"
variation 4665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989942450"
variation 4666..4676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gcctgggcttg"
/db_xref="dbSNP:1645833247"
variation 4669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:892881648"
variation 4670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383382"
variation 4678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645833421"
variation 4679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011206378"
variation 4680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567921238"
variation 4682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:966909637"
variation 4684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914383203"
variation 4687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383404"
variation 4690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999755697"
variation 4696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264842778"
variation 4702..4703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645833861"
variation 4704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354127015"
variation 4706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645833991"
variation 4711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529226907"
variation 4718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224575972"
variation 4719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727485"
variation 4729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:11263837"
variation 4731..4747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggagg"
/replace="tggaggccagctggagg"
/db_xref="dbSNP:1482570994"
variation 4732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955570714"
variation 4738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834334"
variation 4740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490230038"
variation 4741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1252219325"
variation 4753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383462"
variation 4754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:985943795"
variation 4757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:147872657"
variation 4759..4761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1367279967"
variation 4767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645834800"
variation 4769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834859"
variation 4770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834930"
variation 4774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645835003"
variation 4778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575432473"
variation 4783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727526"
variation 4784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164723063"
variation 4787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626633"
variation 4793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180986599"
variation 4796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538396559"
variation 4797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1441473989"
variation 4798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835457"
variation 4802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835540"
variation 4803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835612"
variation 4807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1158965724"
variation 4808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645835712"
variation 4811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835761"
variation 4813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768629161"
variation 4817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1422319454"
variation 4819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835966"
variation 4820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:539225992"
variation 4829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390797034"
variation 4830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836125"
variation 4836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390373559"
variation 4838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1328762082"
variation 4839..4845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atctatc"
/db_xref="dbSNP:1248093606"
variation 4839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940048856"
variation 4840..4842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1341276282"
variation 4842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836434"
variation 4843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549478819"
variation 4846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645836515"
variation 4849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:981391115"
variation 4853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645836622"
variation 4854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928450240"
variation 4858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383569"
variation 4861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645836781"
variation 4870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645836821"
variation 4876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645836891"
variation 4876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:937119553"
variation 4879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:898638537"
variation 4881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:948854920"
variation 4884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1045068402"
variation 4886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1056043426"
variation 4888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383595"
variation 4891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002958675"
variation 4892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374604719"
variation 4894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:891564764"
variation 4900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837338"
variation 4902..4909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catt"
/replace="cattcatt"
/db_xref="dbSNP:568286493"
variation 4912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:779127991"
variation 4916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837495"
variation 4922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645837557"
variation 4932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645837592"
variation 4933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172946442"
variation 4936..4940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taact"
/replace="taactaact"
/db_xref="dbSNP:763091191"
variation 4939..4946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcct"
/replace="ctcctcct"
/db_xref="dbSNP:1465749168"
variation 4939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301254589"
variation 4940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1404445156"
variation 4941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:566005717"
variation 4942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645837930"
variation 4960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557502697"
variation 4964..4971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gctacagc"
/db_xref="dbSNP:1557626785"
variation 4966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776479735"
variation 4968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267521187"
variation 4972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838154"
variation 4973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838239"
variation 4982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748073066"
variation 4984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357140818"
variation 4986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:148920115"
variation 4989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838456"
variation 4991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041364990"
variation 4992..4993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645838643"
variation 4992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838592"
variation 4993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838705"
variation 5000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:551183965"
variation 5001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307814250"
variation 5010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232095258"
variation 5012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645838886"
variation 5014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838928"
variation 5020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838966"
variation 5021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253817472"
variation 5023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559700666"
variation 5028..5029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1203738330"
variation 5033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645839164"
variation 5034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247992782"
variation 5035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383731"
variation 5038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179212155"
variation 5039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974546690"
variation 5045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839412"
variation 5046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839464"
variation 5047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:999722784"
variation 5052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1029906678"
variation 5056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574738407"
variation 5057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1432895085"
variation 5058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:891379793"
variation 5061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645839882"
variation 5062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174300866"
variation 5074..5079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1030698125"
variation 5078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954617636"
variation 5085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645840096"
variation 5090..5092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="act"
/db_xref="dbSNP:1645840140"
variation 5091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840201"
variation 5093..5094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645840255"
variation 5094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840310"
variation 5097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319940523"
variation 5099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645840847"
variation 5100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:749135264"
variation 5101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987209249"
variation 5106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626922"
variation 5107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383810"
variation 5108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:908518241"
variation 5111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1362408292"
variation 5120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1298812667"
variation 5122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841240"
variation 5125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940101447"
variation 5128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841340"
variation 5129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841375"
variation 5132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774314069"
variation 5133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841478"
variation 5135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018878974"
variation 5138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326383796"
variation 5142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841621"
variation 5143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:962811047"
variation 5144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:569028747"
variation 5145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218561159"
variation 5146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841805"
variation 5148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:974593532"
variation 5157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1243192888"
variation 5158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1488390585"
variation 5163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727754"
variation 5165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401866702"
variation 5169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727758"
variation 5176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727763"
variation 5182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1271378698"
variation 5183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025644941"
variation 5184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:528581690"
variation 5185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842188"
variation 5187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759576331"
variation 5190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842281"
variation 5192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842329"
variation 5194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919992705"
variation 5199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1409869642"
variation 5207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842477"
variation 5209..5212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:948897736"
variation 5209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645842520"
variation 5211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161287709"
variation 5212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1382484440"
variation 5213..5229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctaggatcagggcacta"
/replace="ctaggatcagggcactaggatcagggcacta"
/db_xref="dbSNP:1645842729"
variation 5213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842691"
variation 5215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345701651"
variation 5217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142820733"
variation 5221..5222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645842850"
variation 5227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1435560919"
variation 5229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842923"
variation 5233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:11584551"
variation 5234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301096853"
variation 5235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347106387"
variation 5236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843246"
variation 5238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1405193284"
variation 5242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:951399769"
variation 5243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315279151"
variation 5245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843426"
variation 5248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843474"
variation 5250..5251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tc"
/db_xref="dbSNP:1322495713"
variation 5259..5261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645843565"
variation 5261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727824"
variation 5265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044534109"
variation 5266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1285628921"
variation 5272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226998190"
variation 5273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645843752"
variation 5274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384016"
variation 5280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1219960188"
variation 5283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294435310"
variation 5284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645843975"
variation 5285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645844021"
variation 5286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384041"
variation 5287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844138"
variation 5291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:907449262"
variation 5293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536462158"
variation 5298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:563614918"
variation 5307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181737936"
variation 5313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1249885644"
variation 5315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:531160067"
variation 5316..5325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttctctcctt"
/replace="ttctctccttctctcctt"
/db_xref="dbSNP:1645844480"
variation 5318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844528"
variation 5323..5325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctt"
/db_xref="dbSNP:1645844611"
variation 5323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552823877"
variation 5325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:879655926"
variation 5329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844688"
variation 5331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404716895"
variation 5332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1161533657"
variation 5334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367212903"
variation 5335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425058234"
variation 5337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844925"
variation 5338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571384105"
variation 5339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645845050"
variation 5339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1307085474"
variation 5341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845099"
variation 5344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727887"
variation 5349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767735487"
variation 5350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552050201"
variation 5354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528802065"
variation 5364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443788207"
variation 5365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845349"
variation 5367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190099919"
variation 5368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845472"
variation 5371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256609372"
variation 5372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845584"
variation 5378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021369384"
variation 5381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:947143594"
variation 5387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645845708"
variation 5388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:182744550"
variation 5389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384166"
variation 5395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204874862"
variation 5396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845899"
variation 5401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727918"
variation 5403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645845949"
variation 5408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1272814860"
variation 5411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1190613951"
variation 5416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846085"
variation 5422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846135"
variation 5426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846189"
variation 5427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151051297"
variation 5432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1205425860"
variation 5435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465746348"
variation 5436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172008691"
variation 5438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384210"
variation 5439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1471812605"
variation 5443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727946"
variation 5446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405911669"
variation 5450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645846538"
variation 5451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902852262"
variation 5452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846623"
variation 5453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846660"
variation 5455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:954806567"
variation 5456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846742"
variation 5458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:983361467"
variation 5464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645846852"
variation 5470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645846900"
variation 5471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645846957"
variation 5473..5479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:1645847010"
variation 5485..5488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaga"
/db_xref="dbSNP:1645847063"
variation 5490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727972"
variation 5496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167691315"
variation 5498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847159"
variation 5501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1394022800"
variation 5503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:932947717"
variation 5506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645847305"
variation 5509..5511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ata"
/replace="atata"
/db_xref="dbSNP:1329050564"
variation 5511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847415"
variation 5512..5515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1358079609"
variation 5515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772382251"
variation 5516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550680342"
variation 5519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1384154969"
variation 5521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645847733"
variation 5522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:961395198"
variation 5524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847828"
variation 5524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645847862"
variation 5526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645847914"
variation 5528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728004"
variation 5543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847954"
variation 5545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764511304"
variation 5546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1341839128"
variation 5547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187348990"
variation 5550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278180244"
variation 5552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440823891"
variation 5554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645848224"
variation 5555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848273"
variation 5561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:970088425"
variation 5563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848359"
variation 5564..5569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtggtg"
/db_xref="dbSNP:1645848479"
variation 5564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276597545"
variation 5566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461734061"
variation 5568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384324"
variation 5569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342434963"
variation 5575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848655"
variation 5579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219399290"
variation 5587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:539113284"
variation 5588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980694120"
variation 5589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1371146862"
variation 5590..5591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1645848996"
variation 5590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891356896"
variation 5591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849048"
variation 5592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401665842"
variation 5596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310304736"
variation 5600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849252"
variation 5614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928789700"
variation 5617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256324753"
variation 5619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1467820619"
variation 5620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:557539448"
variation 5621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849521"
variation 5623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728056"
variation 5625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754200663"
variation 5626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849600"
variation 5627..5628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:749776818"
variation 5636..5638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gtg"
/db_xref="dbSNP:1645849756"
variation 5636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757754773"
variation 5638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435029828"
variation 5640..5641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1316774797"
variation 5640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1320249981"
variation 5642..5646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1328627531"
variation 5642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849999"
variation 5643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850105"
variation 5644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850140"
variation 5646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557627407"
variation 5648..5652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ccccc"
/db_xref="dbSNP:1645850330"
variation 5648..5652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:770805142"
variation 5648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018434015"
variation 5650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850511"
variation 5652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:898696084"
variation 5655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645850599"
variation 5656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274532947"
variation 5659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:41308339"
variation 5664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850811"
variation 5671..5673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645850893"
variation 5671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850851"
variation 5673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225535156"
variation 5675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477947563"
variation 5676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025695548"
variation 5678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197997922"
variation 5680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1263862850"
variation 5683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:951451722"
variation 5685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851215"
variation 5688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328507462"
variation 5689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645851305"
variation 5693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002846536"
variation 5705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204485880"
variation 5706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035711401"
variation 5707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426622329"
variation 5708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645851511"
variation 5713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448579369"
variation 5714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851605"
variation 5717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851648"
variation 5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728166"
variation 5724..5726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1193605967"
variation 5724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958630214"
variation 5728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851808"
variation 5732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479270221"
variation 5739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728182"
variation 5740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178071830"
variation 5741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645851930"
variation 5747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851973"
variation 5751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042669059"
variation 5753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1456242492"
variation 5756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852094"
variation 5758..5761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:759259838"
variation 5758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852142"
variation 5761..5772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcttgcttgct"
/replace="tgcttgcttgcttgct"
/db_xref="dbSNP:900265053"
variation 5761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645852241"
variation 5762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645852361"
variation 5766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401689084"
variation 5769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852451"
variation 5770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:191912446"
variation 5772..5773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tgctggcc"
/db_xref="dbSNP:1553157487"
variation 5773..5780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggcc"
/replace="ggccggcc"
/replace="ggccggccggcc"
/db_xref="dbSNP:1296575768"
variation 5774..5788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcctgcc"
/replace="gccggcctgcctgccggcctgcctgcc"
/db_xref="dbSNP:1362617855"
variation 5774..5784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcc"
/replace="gccggcctgccggcctgcc"
/db_xref="dbSNP:1645852668"
variation 5775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852759"
variation 5776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914403513"
variation 5777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:968992815"
variation 5778..5810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcctgcctg"
/replace="gcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
g"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctgcctg"
/db_xref="dbSNP:rs372821782"
variation 5778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282666371"
variation 5780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645853224"
variation 5781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1365616037"
variation 5781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:977225175"
variation 5782..5788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcc"
/replace="gcctgccggcctgcc"
/db_xref="dbSNP:747270933"
variation 5782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426944064"
variation 5784..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1571384632"
variation 5784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301971013"
variation 5785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370162251"
variation 5786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1389789240"
variation 5788..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgcctgtctgcctgcctgcctgcctgcctgt
ctgcct"
/db_xref="dbSNP:1645853684"
variation 5789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645853731"
variation 5792..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgtctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1645853771"
variation 5793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1316118886"
variation 5794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1309282984"
variation 5795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645854320"
variation 5796..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1336375849"
variation 5798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384653"
variation 5799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963254787"
variation 5800..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgtctgcct"
/replace="ctgcctgcctgtctgcctgcctgtctgcct"
/db_xref="dbSNP:1237611797"
variation 5802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645854627"
variation 5803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:555364099"
variation 5804..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgtctgcct"
/replace="ctgcctgtctgcctgtctgcct"
/db_xref="dbSNP:1287917302"
variation 5804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292098066"
variation 5805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645854848"
variation 5806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645854897"
variation 5807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557627632"
variation 5808..5819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctgtctgcctat"
/db_xref="dbSNP:1252062550"
variation 5808..5814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgtctg"
/replace="ctgtctgtctg"
/db_xref="dbSNP:200133723"
variation 5808..5810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgactg"
/db_xref="dbSNP:1553157504"
variation 5810..5811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="cc"
/db_xref="dbSNP:770398111"
variation 5811..5812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645855334"
variation 5811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:112770520"
variation 5812..5817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcct"
/db_xref="dbSNP:1183589156"
variation 5813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645855424"
variation 5814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:571445890"
variation 5816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855513"
variation 5833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855558"
variation 5835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645855603"
variation 5840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383916478"
variation 5844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051361821"
variation 5848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1164574343"
variation 5849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645855799"
variation 5855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1389894962"
variation 5857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221324706"
variation 5862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1026961947"
variation 5864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:910240712"
variation 5867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395510442"
variation 5868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942960160"
variation 5870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757921944"
variation 5871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1489203442"
variation 5875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1380448830"
variation 5876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1193414679"
variation 5877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384799"
variation 5879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775414815"
variation 5881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856560"
variation 5883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315494134"
variation 5884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:898752248"
variation 5885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1224797571"
variation 5890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928691509"
variation 5891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202463972"
variation 5892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996046803"
variation 5895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856886"
variation 5896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728410"
variation 5898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419008182"
variation 5901..5902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1241877536"
variation 5901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1463077268"
variation 5902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047275375"
variation 5903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857163"
variation 5905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1184703413"
variation 5908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887166316"
variation 5909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1427104575"
variation 5911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002980449"
variation 5916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420492800"
variation 5924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857445"
variation 5933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857490"
variation 5935..5936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645857539"
variation 5936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645857582"
variation 5939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857646"
variation 5943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1302816968"
variation 5946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035677605"
variation 5951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:913494355"
variation 5952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728446"
variation 5953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857860"
variation 5955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857900"
variation 5962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557627845"
variation 5971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645857980"
variation 5978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571384916"
variation 5979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174403877"
variation 5987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762492099"
variation 5992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958990209"
variation 5993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:779696256"
variation 5995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1337231783"
variation 6001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1380300635"
variation 6005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645858678"
variation 6008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1297341203"
variation 6009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307689490"
variation 6014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:947601773"
variation 6018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260732717"
variation 6024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859042"
variation 6027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645859089"
variation 6032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324999845"
variation 6034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204871772"
variation 6039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1438787912"
variation 6042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645859379"
variation 6044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1021921367"
variation 6045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968671573"
variation 6053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763849097"
variation 6055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645859555"
variation 6058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042724086"
variation 6059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645859650"
variation 6060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859708"
variation 6061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567274274"
variation 6076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661619"
variation 6077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:150347120"
variation 6081..6085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1431544208"
variation 6084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987216748"
variation 6085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546276346"
variation 6086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470343952"
variation 6088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:910216586"
variation 6093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344515647"
variation 6108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860254"
variation 6114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:192229737"
variation 6117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290445387"
variation 6118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362339452"
variation 6124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1403969851"
variation 6128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860504"
variation 6129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244761611"
variation 6129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287368967"
variation 6131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1037381878"
variation 6136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860681"
variation 6140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728519"
variation 6142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280900615"
variation 6146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860783"
variation 6153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1346907933"
variation 6154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:920145968"
variation 6155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860929"
variation 6163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528689854"
variation 6165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645861030"
variation 6166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1284226539"
variation 6168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:931573500"
variation 6170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315693552"
variation 6171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:540957769"
variation 6182..6185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1221573684"
variation 6183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861365"
variation 6188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368046981"
variation 6190..6199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gagaa"
/replace="gagaagagaa"
/db_xref="dbSNP:1645861470"
variation 6194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1490268876"
variation 6200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231826043"
variation 6202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457670138"
variation 6204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220619177"
variation 6206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1271306211"
variation 6213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1047241439"
variation 6217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004756207"
variation 6220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861848"
variation 6227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405839722"
variation 6235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769653660"
variation 6242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645861970"
variation 6255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417265705"
variation 6257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728576"
variation 6264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161126832"
variation 6266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360937850"
variation 6268..6272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gatcc"
/replace="gatccgatcc"
/db_xref="dbSNP:1645862149"
variation 6277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562224713"
variation 6279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:899097755"
variation 6282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002947890"
variation 6284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057471908"
variation 6288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645862459"
variation 6292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862508"
variation 6294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:138074007"
variation 6295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645862610"
variation 6303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645862666"
variation 6305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440747757"
variation 6308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645862778"
variation 6309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1162890296"
variation 6313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862869"
variation 6319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894562681"
variation 6321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754406043"
variation 6323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728607"
variation 6328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:772201195"
variation 6332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148728609"
variation 6345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645863100"
variation 6346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863154"
variation 6347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1021640249"
variation 6353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:141089342"
variation 6354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998758461"
variation 6355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244212532"
variation 6355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294278586"
variation 6357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490584781"
variation 6358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960365327"
variation 6359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775545090"
variation 6360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481620700"
variation 6362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:568795494"
variation 6364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380815145"
variation 6365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863841"
variation 6369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987268068"
variation 6377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1443819358"
variation 6380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144915813"
variation 6382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571385299"
variation 6383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864076"
variation 6385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864138"
variation 6386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1377348939"
variation 6387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645864227"
variation 6393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:374706238"
variation 6394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113615155"
variation 6396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864372"
variation 6401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864425"
variation 6402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1282216452"
variation 6408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645864544"
variation 6409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645864590"
variation 6412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405605719"
variation 6414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864668"
variation 6416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380813945"
variation 6418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:973456920"
variation 6419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728666"
variation 6420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864840"
variation 6421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645864882"
variation 6423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760929529"
variation 6426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551057779"
variation 6429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865280"
variation 6430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1332689680"
variation 6432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:114256824"
variation 6433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197273641"
variation 6435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645865489"
variation 6437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184309288"
variation 6449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983063796"
variation 6453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260624813"
variation 6454..6458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttt"
/db_xref="dbSNP:1645865803"
variation 6456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458613385"
variation 6458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865916"
variation 6459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922161015"
variation 6465..6473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:370557448"
variation 6465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309399501"
variation 6471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866192"
variation 6472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866233"
variation 6473..6474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aaa"
/db_xref="dbSNP:1645866326"
variation 6473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:987536748"
variation 6474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187213249"
variation 6475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385436"
variation 6476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1236111557"
variation 6477..6479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:911645288"
variation 6480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1473876167"
variation 6484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181616122"
variation 6489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940409522"
variation 6496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472999025"
variation 6499..6500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1167019359"
variation 6499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866716"
variation 6500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1182705289"
variation 6504..6509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gggcag"
/db_xref="dbSNP:1645866894"
variation 6506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1036208175"
variation 6511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571385482"
variation 6516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867033"
variation 6517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728745"
variation 6518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:555660904"
variation 6520..6526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="actgact"
/db_xref="dbSNP:1422983575"
variation 6520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404662978"
variation 6522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867197"
variation 6526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1451113438"
variation 6527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339192698"
variation 6529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1341515389"
variation 6532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430446901"
variation 6535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464188223"
variation 6537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645867423"
variation 6540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867458"
variation 6543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867490"
variation 6544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1364387032"
variation 6551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867572"
variation 6555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:572628298"
variation 6558..6559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1201765786"
variation 6562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645867751"
variation 6566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:930444612"
variation 6568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645867836"
variation 6575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045041411"
variation 6576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530603610"
variation 6583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:78530614"
variation 6584..6585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1476204564"
variation 6584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645868037"
variation 6585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894522255"
variation 6587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776882598"
variation 6592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868215"
variation 6594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868270"
variation 6596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1448255656"
variation 6599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269278192"
variation 6600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948849183"
variation 6603..6604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645868454"
variation 6606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868500"
variation 6607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762170192"
variation 6609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043438858"
variation 6612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868671"
variation 6613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385608"
variation 6617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403509038"
variation 6618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868786"
variation 6620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868819"
variation 6624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:904567735"
variation 6632..6633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1400592274"
variation 6633..6640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tca"
/replace="tcatctca"
/db_xref="dbSNP:1219867000"
variation 6633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645868959"
variation 6635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869071"
variation 6636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645869125"
variation 6638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869167"
variation 6639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765675340"
variation 6640..6642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1328506458"
variation 6643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571385649"
variation 6647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1319157924"
variation 6651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1343778835"
variation 6654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557084074"
variation 6662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1036062361"
variation 6664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276584304"
variation 6669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895920140"
variation 6671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276910052"
variation 6672..6673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645869877"
variation 6672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:575661209"
variation 6673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869937"
variation 6674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869988"
variation 6677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1010249007"
variation 6679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2148728856"
variation 6679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870081"
variation 6680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020314191"
variation 6681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546362220"
variation 6690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1479199859"
variation 6692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645870356"
variation 6694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890382760"
variation 6695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008657978"
variation 6698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763548820"
variation 6702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157272761"
variation 6704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645870598"
variation 6705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953725615"
variation 6709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645870679"
variation 6710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:964799598"
variation 6713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302826706"
variation 6720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870815"
variation 6723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973205940"
variation 6730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911516959"
variation 6731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645870970"
variation 6734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195863102"
variation 6736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424452573"
variation 6740..6745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1477632037"
variation 6740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:940323449"
variation 6743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:920339228"
variation 6746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1355662531"
variation 6749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170784368"
variation 6750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:930497110"
variation 6757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571385821"
variation 6760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645871464"
variation 6761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645871530"
variation 6766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1290634553"
variation 6768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645871697"
variation 6768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558270328"
variation 6769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1211203653"
variation 6772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044886782"
variation 6775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:138767681"
variation 6778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:939242447"
variation 6784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:950401389"
variation 6787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1185440121"
variation 6789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1057145760"
variation 6791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872395"
variation 6792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895835109"
variation 6794..6798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1440738836"
variation 6797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571385873"
variation 6806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:879157668"
variation 6808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872617"
variation 6816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872675"
variation 6824
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645872766"
variation 6826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872813"
variation 6829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645872840"
variation 6832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163376199"
variation 6833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645872979"
variation 6834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983116176"
variation 6837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383722185"
variation 6838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908759750"
variation 6840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728950"
variation 6841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728953"
variation 6842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:540494493"
variation 6843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395952822"
variation 6845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645873310"
variation 6849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:904610426"
variation 6850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385919"
variation 6853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148728967"
variation 6856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1326832455"
variation 6859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:371613930"
variation 6863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645873813"
variation 6864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447359167"
variation 6865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:10159166"
variation 6867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953666043"
variation 6868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385961"
variation 6870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344366892"
variation 6871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874205"
variation 6875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916104249"
variation 6877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874331"
variation 6879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874374"
variation 6888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874429"
variation 6889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:373746606"
variation 6891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265650361"
variation 6893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1009590328"
variation 6895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645874686"
variation 6896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544844168"
variation 6902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386002"
variation 6905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:375483845"
variation 6906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645874945"
variation 6907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1458625794"
variation 6908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019173380"
variation 6909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875109"
variation 6910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875195"
variation 6912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273645163"
variation 6913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875305"
variation 6916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1165828405"
variation 6918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875441"
variation 6920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746073637"
variation 6921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645875572"
variation 6924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645875655"
variation 6925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875707"
variation 6927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1460567228"
variation 6936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875815"
variation 6937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875867"
variation 6939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875920"
variation 6942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875969"
variation 6944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876036"
variation 6950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1169758238"
variation 6951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:961745768"
variation 6956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562192835"
variation 6957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1043187507"
variation 6961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:904619927"
variation 6967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380376895"
variation 6976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729053"
variation 6986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645876532"
variation 6991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397538632"
variation 6995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876620"
variation 6998..7000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1313037150"
variation 7004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876714"
variation 7005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487402670"
variation 7006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876817"
variation 7008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645876859"
variation 7010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:920349220"
variation 7014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148729069"
variation 7017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645876981"
variation 7020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779121299"
variation 7021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877127"
variation 7025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729074"
variation 7027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:532756658"
variation 7031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877237"
variation 7033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:551094472"
variation 7039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877341"
variation 7040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877397"
variation 7042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645877438"
variation 7043..7044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645877485"
variation 7044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877531"
variation 7046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1053063998"
variation 7049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645877620"
variation 7060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371449404"
variation 7064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980648055"
variation 7069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317917409"
variation 7074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645877810"
variation 7079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203660652"
variation 7082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877886"
variation 7084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1263954548"
variation 7084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877939"
variation 7091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484473665"
variation 7092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1182776319"
variation 7094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878184"
variation 7097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890351554"
variation 7098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748582631"
variation 7099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451154583"
variation 7113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878407"
variation 7115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426972330"
variation 7120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878525"
variation 7123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386195"
variation 7124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196028282"
variation 7125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645878800"
variation 7127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1008842113"
variation 7129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878921"
variation 7132..7137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="caca"
/replace="cacaca"
/db_xref="dbSNP:926420699"
variation 7132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878969"
variation 7147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1379364534"
variation 7149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:186734072"
variation 7155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755885015"
variation 7157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467484723"
variation 7163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645879289"
variation 7165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:913819772"
variation 7170..7175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agc"
/replace="agcagc"
/db_xref="dbSNP:2148729156"
variation 7172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:527357395"
variation 7173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:900365728"
variation 7179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157779349"
variation 7181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:946087269"
variation 7182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645879642"
variation 7184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378292176"
variation 7186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1222356299"
variation 7189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645879833"
variation 7190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645879888"
variation 7194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729179"
variation 7195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:777420444"
variation 7196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314501170"
variation 7197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880056"
variation 7199..7201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctc"
/db_xref="dbSNP:1645880102"
variation 7201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041669384"
variation 7214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386294"
variation 7215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645880326"
variation 7216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880377"
variation 7220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880421"
variation 7225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645880469"
variation 7229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880596"
variation 7237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880650"
variation 7248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639867973"
variation 7249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558373845"
variation 7250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:904621610"
variation 7255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485093351"
variation 7258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219140446"
variation 7269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000206497"
variation 7273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729205"
variation 7274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772267788"
variation 7276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027366153"
variation 7279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197401612"
variation 7285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729212"
variation 7287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889305740"
variation 7288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:749293608"
variation 7289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645881473"
variation 7291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645881534"
variation 7307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1176622861"
variation 7310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363083094"
variation 7312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:548918631"
variation 7316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019646938"
variation 7317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004521790"
variation 7323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324961860"
variation 7326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360735202"
variation 7327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1333275975"
variation 7328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567411609"
variation 7339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369010287"
variation 7340..7343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgta"
/replace="tgtatgta"
/db_xref="dbSNP:1442309469"
variation 7341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220376437"
variation 7344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882353"
variation 7345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770825835"
variation 7346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882492"
variation 7347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027300752"
variation 7348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287140063"
variation 7353..7354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1490253808"
variation 7354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645882705"
variation 7357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951788921"
variation 7362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980959266"
variation 7367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488846783"
variation 7370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1352008025"
variation 7371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882980"
variation 7372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883030"
variation 7374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249705353"
variation 7375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883150"
variation 7380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544330785"
variation 7383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645883275"
variation 7385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883329"
variation 7387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413972925"
variation 7393..7394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645883489"
variation 7393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:960864590"
variation 7398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537750959"
variation 7400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993129847"
variation 7402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916062408"
variation 7403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351170931"
variation 7406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883831"
variation 7408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149237486"
variation 7410..7414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="catca"
/db_xref="dbSNP:913831161"
variation 7410..7411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="cagca"
/db_xref="dbSNP:539061324"
variation 7412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:144443110"
variation 7413..7435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cagcagcagca"
/replace="cagcagcagcagca"
/replace="cagcagcagcagcagca"
/replace="cagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagcagca"
/db_xref="dbSNP:rs889197162"
variation 7413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1355722293"
variation 7414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203872063"
variation 7415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:575056563"
variation 7419..7420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttgttgt"
/db_xref="dbSNP:1269588845"
variation 7422..7423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctatggct"
/db_xref="dbSNP:1452072720"
variation 7424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1177987270"
variation 7428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1456405949"
variation 7431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cttc"
/db_xref="dbSNP:1645885688"
variation 7431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645885640"
variation 7433..7434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gcggc"
/db_xref="dbSNP:1645885789"
variation 7433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180372984"
variation 7436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885837"
variation 7437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645885889"
variation 7441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885938"
variation 7442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148729327"
variation 7443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:934766659"
regulatory 7449..7454
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: TATAAA"
variation 7450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886069"
variation 7452..7454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645886176"
variation 7452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886118"
variation 7453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886223"
variation 7455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:539822482"
variation 7456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886321"
variation 7458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645886384"
variation 7460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729344"
variation 7461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:191490961"
variation 7462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645886496"
variation 7463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886526"
variation 7464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:147996549"
variation 7469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:534259020"
variation 7470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944611441"
variation 7471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386624"
variation 7472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886834"
variation 7475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386633"
variation 7476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1367463573"
variation 7477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887018"
variation 7478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:184023415"
polyA_site 7479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="major polyA site"
variation 7483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574175798"
variation 7484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:544618983"
variation 7486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386676"
variation 7490..7494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tctct"
/db_xref="dbSNP:1645887327"
variation 7494..7502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/db_xref="dbSNP:rs796351016"
variation 7500..7501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148729387"
variation 7501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645887490"
variation 7502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867387436"
variation 7503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390866641"
variation 7510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571386715"
variation 7511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286216662"
variation 7512..7515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148729393"
variation 7512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188911199"
variation 7517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645887831"
variation 7520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1214158289"
variation 7523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256255072"
variation 7524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887970"
variation 7528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645888019"
variation 7529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960456203"
variation 7533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888120"
variation 7535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048938605"
variation 7537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182195447"
variation 7541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577246142"
variation 7542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645888320"
variation 7543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888365"
variation 7549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004657513"
variation 7552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207790449"
variation 7567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238937216"
variation 7575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472929518"
variation 7579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888623"
variation 7580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888676"
variation 7581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770258663"
variation 7585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889020"
variation 7586..7587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1420923125"
variation 7586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1034669992"
variation 7589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172080513"
variation 7595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960444785"
variation 7603..7606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcat"
/db_xref="dbSNP:1413226399"
variation 7606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336586532"
variation 7609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:979339120"
variation 7613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430287896"
variation 7615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276524536"
variation 7616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340047651"
variation 7617..7618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:746001460"
variation 7618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:925197893"
variation 7622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571386829"
variation 7627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267273030"
variation 7629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219290317"
variation 7632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889940"
variation 7634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282674801"
variation 7639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890236"
variation 7643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890277"
variation 7646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890320"
variation 7650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344247107"
variation 7652..7655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1645890475"
variation 7652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:773678037"
variation 7654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890524"
variation 7655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1280477276"
variation 7658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890662"
variation 7659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1442783041"
variation 7665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197921213"
variation 7666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:986114472"
variation 7668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890878"
variation 7670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890925"
variation 7671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260563689"
variation 7677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891060"
variation 7686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891097"
variation 7692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891142"
variation 7694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489008222"
variation 7695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763601554"
variation 7696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766939124"
variation 7698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477336117"
variation 7702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645891407"
variation 7704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178959666"
variation 7705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255242825"
variation 7708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891545"
variation 7709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023183515"
variation 7711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1189238389"
variation 7722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891676"
variation 7727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891738"
variation 7730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296624955"
variation 7731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891932"
variation 7732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:970729207"
variation 7734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:978931276"
variation 7738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185476341"
variation 7740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645892133"
variation 7742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645892172"
variation 7745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645892214"
variation 7746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:956112691"
variation 7747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477240493"
variation 7748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:759023126"
variation 7754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645892407"
variation 7755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302643848"
variation 7765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892494"
variation 7767..7771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:2148729521"
variation 7768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892547"
variation 7769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:911887757"
variation 7770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:898025322"
variation 7773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661620"
variation 7774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049380833"
variation 7778..7780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gga"
/replace="ggagga"
/db_xref="dbSNP:1645892854"
variation 7778..7779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:764616411"
variation 7779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239124372"
variation 7783..7784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645892937"
variation 7787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1283570239"
variation 7789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039451250"
variation 7793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:921842803"
variation 7794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893134"
variation 7796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1355436608"
variation 7797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:527401943"
variation 7800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467667265"
variation 7801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893334"
variation 7804..7806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:71573710"
variation 7812..7814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1201704138"
variation 7814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893459"
variation 7821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048906465"
variation 7826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1299064106"
variation 7829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247766098"
variation 7830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549014350"
variation 7832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1157249630"
variation 7834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752455063"
variation 7839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645893821"
variation 7843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1394491176"
variation 7850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:888029350"
variation 7851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:141708021"
variation 7862..7868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggag"
/replace="ggaggag"
/db_xref="dbSNP:1330261261"
variation 7865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:896232710"
variation 7867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387090"
variation 7875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645894291"
variation 7879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387095"
variation 7879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645894397"
variation 7885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645894441"
variation 7889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388570987"
variation 7890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645894524"
variation 7894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011886579"
variation 7895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1325493005"
variation 7902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1033313595"
variation 7903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218020464"
variation 7909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023742547"
variation 7911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906099748"
variation 7914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896245769"
variation 7917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895127"
variation 7918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013363402"
variation 7921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895229"
variation 7922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1353691617"
variation 7924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000435153"
variation 7925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:529304195"
variation 7926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542691451"
variation 7928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645895540"
variation 7931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645895647"
variation 7931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:988939718"
variation 7935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:979226030"
variation 7936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018993608"
variation 7940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895806"
variation 7942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895843"
variation 7944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183272091"
variation 7949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1032227537"
variation 7950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11800878"
variation 7953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367583172"
variation 7954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753609764"
variation 7955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465046339"
variation 7957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645896209"
variation 7959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329223357"
variation 7962..7964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645896334"
variation 7962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645896294"
variation 7972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645896399"
variation 7973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378916834"
variation 7974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:190765482"
variation 7976..7979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645896590"
variation 7976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311690893"
variation 7977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:984738697"
variation 7979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729640"
variation 7985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944691489"
variation 7994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729643"
variation 7995..7997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aga"
/db_xref="dbSNP:1256497507"
variation 7995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487758792"
variation 7996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148729650"
variation 7999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645897182"
variation 8001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729652"
variation 8008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897231"
variation 8009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976189008"
variation 8011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645897326"
variation 8016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1190800512"
variation 8019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115528846"
variation 8020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197366841"
variation 8022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260527645"
variation 8027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:551808585"
variation 8028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1200272100"
variation 8030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645897780"
variation 8033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897836"
variation 8036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897877"
variation 8039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897924"
variation 8042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897970"
variation 8044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254452984"
variation 8046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425796858"
variation 8047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778783444"
variation 8058..8062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aca"
/replace="acaca"
/db_xref="dbSNP:1423093406"
variation 8059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645898281"
variation 8060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:940472965"
variation 8064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1476877414"
variation 8065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645898453"
variation 8067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049227178"
variation 8068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1402407879"
variation 8075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:909460062"
variation 8076..8077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557630020"
variation 8076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302059480"
variation 8077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571387308"
variation 8078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898841"
variation 8079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898886"
variation 8082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:147293577"
variation 8083..8085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1397482627"
variation 8083
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645898996"
variation 8089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899069"
variation 8091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899120"
variation 8092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899171"
variation 8093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938255812"
variation 8098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11263838"
variation 8100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899415"
variation 8101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899471"
variation 8102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1216218597"
variation 8105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645899572"
variation 8106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:663163"
variation 8107..8108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttata"
/db_xref="dbSNP:1645899747"
variation 8108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899797"
variation 8111..8113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645899845"
variation 8113..8114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1013199093"
variation 8116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042160042"
variation 8122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645900020"
variation 8128..8130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1645900073"
variation 8128..8129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:796743131"
variation 8133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630078"
variation 8138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900249"
variation 8140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1044725499"
variation 8141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645900359"
variation 8143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:902232968"
variation 8144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557630092"
variation 8154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645900525"
variation 8158..8162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1645900560"
variation 8160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376232788"
variation 8161..8172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagagaa"
/replace="aagagaagagaa"
/db_xref="dbSNP:1424350327"
variation 8164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900712"
variation 8165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000663554"
variation 8170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900811"
variation 8176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1032148243"
variation 8177..8178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1645900894"
variation 8179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900937"
variation 8180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729767"
variation 8181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:34764544"
variation 8182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729770"
variation 8183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:903552001"
variation 8185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1000404100"
variation 8188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313153284"
variation 8194..8196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1006832383"
variation 8201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:781125965"
variation 8205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645901266"
variation 8211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397696222"
variation 8212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748441732"
variation 8213..8217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:966105029"
variation 8213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:892052895"
variation 8218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901541"
variation 8224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1342494143"
variation 8232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1314362355"
variation 8235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645901702"
variation 8239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:919342755"
variation 8240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901799"
variation 8247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645901848"
variation 8254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010329201"
variation 8257..8259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1557630174"
variation 8259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215065727"
variation 8260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769882762"
variation 8262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387463"
variation 8263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:574185625"
variation 8264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264075715"
variation 8274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:975260157"
variation 8276..8282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttgttt"
/db_xref="dbSNP:1645902274"
variation 8279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538411096"
variation 8282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:773731413"
variation 8283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951987747"
variation 8284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729816"
variation 8285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902459"
variation 8286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1280795884"
variation 8287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729822"
variation 8291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902565"
variation 8292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729825"
variation 8297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265144990"
variation 8298..8317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtaggagaagaaatcagagt"
/replace="gtaggagaagaaatcagagtgtaggagaagaaatcagagt"
/db_xref="dbSNP:1553157891"
variation 8302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645902976"
variation 8310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487736618"
variation 8313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903083"
variation 8314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749626639"
variation 8316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1417491401"
variation 8316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:938167185"
variation 8317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645903330"
variation 8318..8325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaag"
/replace="agaagaag"
/db_xref="dbSNP:1160082662"
variation 8318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645903375"
variation 8324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1345332379"
variation 8327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903513"
variation 8329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1214054853"
variation 8337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645903616"
variation 8341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:907765237"
variation 8345..8351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaca"
/replace="aacaaca"
/db_xref="dbSNP:1456950828"
variation 8346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903841"
variation 8349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903885"
variation 8350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903931"
variation 8353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729859"
variation 8356..8357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:371771654"
variation 8359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387555"
variation 8360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904086"
variation 8363..8368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645904193"
variation 8363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645904133"
variation 8365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:556310027"
variation 8373..8374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1264683629"
variation 8374..8376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148729868"
variation 8374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904356"
variation 8376..8384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:557690955"
variation 8379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:577932548"
variation 8380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904533"
variation 8382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187611390"
variation 8383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267197074"
variation 8384..8386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1491398912"
variation 8384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645904691"
variation 8385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:375747906"
variation 8385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431961690"
variation 8386..8392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtgt"
/replace="tgtgtgt"
/db_xref="dbSNP:949060752"
variation 8387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771565242"
variation 8388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645905040"
variation 8389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396098897"
variation 8391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419295127"
variation 8392..8401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttaccttt"
/db_xref="dbSNP:1645905198"
variation 8396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645905238"
variation 8398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1042002877"
variation 8404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645905349"
variation 8405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286980669"
variation 8406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321236834"
variation 8410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645905480"
variation 8418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905516"
variation 8420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219505196"
variation 8421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571387653"
variation 8423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1267249623"
variation 8425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:369684987"
variation 8430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905767"
variation 8431..8434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1194112655"
variation 8434..8436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1237414549"
variation 8434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645905861"
variation 8437..8448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gacttacttacg"
/db_xref="dbSNP:1645905983"
variation 8438..8447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acttac"
/replace="acttacttac"
/db_xref="dbSNP:750086957"
variation 8438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906029"
variation 8441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:917773706"
variation 8442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645906224"
variation 8442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906185"
variation 8446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1362524771"
variation 8447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645906455"
variation 8447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:61555210"
variation 8448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293016194"
variation 8449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774945280"
variation 8459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045258462"
variation 8468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351045545"
variation 8472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645906718"
variation 8473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387722"
variation 8474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565480687"
variation 8475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182177708"
variation 8479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331242413"
variation 8486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906985"
variation 8488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572003492"
variation 8493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398619650"
variation 8496..8499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:754918941"
variation 8498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280462375"
variation 8502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:936305098"
variation 8505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226766659"
variation 8507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1052060548"
variation 8515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1352780824"
variation 8519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:892022079"
variation 8520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314948396"
variation 8523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542039100"
variation 8525..8530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cac"
/replace="caccac"
/db_xref="dbSNP:1645907567"
variation 8526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907624"
variation 8527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645907679"
variation 8532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645907731"
variation 8533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387811"
variation 8539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040534105"
variation 8542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902042514"
variation 8545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907910"
variation 8553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645907960"
variation 8555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908010"
variation 8557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387839"
variation 8561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645908075"
variation 8563..8568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aataaa"
/db_xref="dbSNP:1317146102"
variation 8566..8574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaac"
/replace="aaacaaaac"
/db_xref="dbSNP:997523767"
variation 8570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767123720"
variation 8573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387863"
variation 8578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387867"
variation 8583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908405"
variation 8585..8592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tcctagcc"
/db_xref="dbSNP:1645908448"
variation 8591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908497"
variation 8594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatatta"
/db_xref="dbSNP:1645908602"
variation 8594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029459149"
variation 8600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387884"
variation 8601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774834541"
variation 8610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908777"
variation 8611..8612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645908887"
variation 8611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908816"
variation 8612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233198421"
variation 8613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908978"
variation 8614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645909028"
variation 8616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730012"
variation 8621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909071"
variation 8627..8632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tag"
/replace="tagtag"
/db_xref="dbSNP:1645909107"
variation 8631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909150"
variation 8639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762839218"
variation 8640..8648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tattt"
/replace="tatttattt"
/db_xref="dbSNP:1179746891"
variation 8641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909344"
variation 8645..8646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1263195438"
variation 8650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909441"
variation 8651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475235403"
variation 8652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645909532"
variation 8653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909578"
variation 8654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909620"
variation 8656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006202972"
variation 8659..8665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctt"
/replace="tcttctt"
/db_xref="dbSNP:1170643933"
variation 8663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645909760"
variation 8664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387944"
variation 8667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422145745"
variation 8674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:375451995"
variation 8679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909930"
variation 8693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1014957927"
variation 8696..8700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:909283444"
variation 8697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:961944436"
variation 8702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1196097951"
variation 8703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645910202"
variation 8703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645910166"
variation 8706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645910251"
variation 8709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253996075"
variation 8711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:992521972"
variation 8712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910417"
variation 8718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910458"
variation 8719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910515"
variation 8721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:991359427"
variation 8722..8723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645910622"
variation 8724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:917757843"
variation 8725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:969590169"
variation 8727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218063131"
variation 8730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439531364"
variation 8735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911357"
variation 8739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557630522"
variation 8740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980636381"
variation 8741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1316018304"
variation 8745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911565"
variation 8746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:925003738"
variation 8749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645911655"
variation 8750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176998308"
variation 8755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911744"
variation 8756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936440744"
variation 8757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911840"
variation 8762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645911885"
variation 8765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216184695"
variation 8773..8774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645911975"
variation 8775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273527169"
variation 8776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645912066"
variation 8777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912107"
variation 8779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645912153"
variation 8783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1441615560"
variation 8784..8787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1207643714"
variation 8785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:918185284"
variation 8786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485770805"
variation 8792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1192327329"
variation 8795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949611226"
variation 8799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479091509"
variation 8800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977746888"
variation 8801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912933"
variation 8802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168993980"
variation 8806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1401515206"
variation 8811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645913138"
variation 8812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571388106"
variation 8814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913242"
variation 8820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:923632669"
variation 8823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1178558224"
variation 8827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645913385"
variation 8832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185191307"
variation 8833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348252754"
variation 8838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645913563"
variation 8841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913592"
variation 8846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459362590"
variation 8854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:913598862"
variation 8858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296441105"
variation 8861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255355390"
variation 8863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053574204"
variation 8872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645914337"
variation 8880..8881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tacatta"
/db_xref="dbSNP:1645914441"
variation 8880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645914395"
variation 8881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:946293747"
variation 8882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cattatc"
/db_xref="dbSNP:1645914549"
variation 8884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914597"
variation 8888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730137"
variation 8891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645914643"
variation 8892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388164"
variation 8896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344082505"
variation 8898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041064870"
variation 8899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914949"
variation 8907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148730146"
variation 8908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:902102576"
variation 8913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348171002"
variation 8916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041242279"
variation 8921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260498192"
variation 8927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915204"
variation 8931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488977942"
variation 8933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996721403"
variation 8935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246608446"
variation 8941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915401"
variation 8947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050633707"
variation 8951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645915497"
variation 8952..8958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggt"
/replace="tggtggt"
/db_xref="dbSNP:1645915544"
variation 8954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:372984594"
variation 8957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1193311041"
variation 8958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311204694"
variation 8962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645915762"
variation 8967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557630747"
variation 8969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571388234"
variation 8972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760427087"
variation 8980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025546631"
variation 8983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419395934"
variation 8985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:561018703"
variation 8992..8993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645916191"
variation 8994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1362587577"
variation 9002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916291"
variation 9004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645916333"
variation 9010..9020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttgttatttct"
/db_xref="dbSNP:886475700"
variation 9014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763687211"
variation 9016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016353899"
variation 9021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:531279755"
variation 9033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:959688040"
variation 9042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916654"
variation 9043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645916697"
variation 9052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916781"
variation 9058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:962078524"
variation 9059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:868779519"
variation 9061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917001"
variation 9063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388284"
variation 9064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239056012"
variation 9066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645917148"
variation 9067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917198"
variation 9069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025076280"
variation 9071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1287091044"
variation 9078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917377"
variation 9079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917438"
variation 9083
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917492"
variation 9084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917535"
variation 9090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1323048375"
variation 9091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917625"
variation 9093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917669"
variation 9097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917718"
variation 9101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917769"
variation 9104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917834"
variation 9105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013592131"
variation 9108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025276256"
variation 9111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918010"
variation 9113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918050"
variation 9115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645918116"
variation 9117..9123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttcctct"
/db_xref="dbSNP:1645918165"
variation 9122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:969343335"
variation 9123..9138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tggaggccaagtgttg"
/db_xref="dbSNP:531097561"
variation 9125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918352"
variation 9132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288469844"
variation 9138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457711634"
variation 9143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:924187437"
variation 9144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936380126"
variation 9146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918640"
variation 9148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439445401"
variation 9149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980987145"
variation 9154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:188289018"
variation 9155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918843"
variation 9156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918909"
variation 9158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1470605990"
variation 9163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:375321641"
variation 9171..9173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1234983001"
variation 9173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919134"
variation 9174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919188"
variation 9175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403601243"
variation 9180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1327825640"
variation 9181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:910981528"
variation 9182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645919439"
variation 9183..9194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agccagccagcc"
/replace="agccagccagccagcc"
/db_xref="dbSNP:1181550295"
variation 9184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1411707007"
variation 9186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630912"
variation 9189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:957770044"
variation 9191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645919705"
variation 9193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942413140"
variation 9195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337188989"
variation 9197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1040900849"
variation 9200..9205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645919966"
variation 9202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1283098745"
variation 9203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645920093"
variation 9207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730297"
variation 9208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353624234"
variation 9213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1476268804"
variation 9217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:901028900"
variation 9221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457678064"
variation 9231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920365"
variation 9233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197180703"
variation 9241..9245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gaaga"
/replace="gaagaaga"
/db_xref="dbSNP:140864"
variation 9241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920503"
variation 9242..9243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:34307163"
variation 9243..9246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:35814364"
variation 9243..9244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="ga"
/db_xref="dbSNP:869263455"
variation 9243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201441860"
variation 9247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:550020187"
variation 9249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438623533"
variation 9250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047055048"
variation 9251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:888328294"
variation 9259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921198"
variation 9260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730337"
variation 9264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1006231276"
variation 9272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921275"
variation 9274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645921336"
variation 9277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181116037"
variation 9279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921436"
variation 9281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167074194"
variation 9282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333074315"
variation 9284..9285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645921609"
variation 9285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921660"
variation 9286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1016651001"
variation 9287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645921779"
variation 9289..9291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="ata"
/db_xref="dbSNP:555724154"
variation 9289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756987293"
variation 9290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921958"
variation 9295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571388519"
variation 9297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631025"
variation 9301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1012769642"
variation 9302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730355"
variation 9303..9304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:2148730356"
variation 9304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987884081"
variation 9305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391670109"
variation 9311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550717064"
variation 9312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025002346"
variation 9318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333064396"
variation 9319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730365"
variation 9320..9325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaagaa"
/db_xref="dbSNP:1645922504"
variation 9320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:970904019"
variation 9322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730371"
variation 9323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1338243940"
variation 9328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730372"
variation 9329..9333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcag"
/db_xref="dbSNP:978227204"
variation 9331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645922642"
variation 9333..9337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1557631060"
variation 9334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922737"
variation 9336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115162190"
variation 9337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631064"
variation 9338..9339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1557631076"
variation 9338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557631071"
variation 9340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922998"
variation 9341..9350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggagga"
/replace="aggaggagga"
/db_xref="dbSNP:1645923047"
variation 9348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317848508"
variation 9349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645923174"
variation 9351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958496568"
variation 9353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1253510461"
variation 9355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:943662728"
variation 9356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547713014"
variation 9357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233292745"
variation 9364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923581"
variation 9367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923620"
variation 9368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645923674"
variation 9370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:976459592"
variation 9371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645923769"
variation 9372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923803"
variation 9373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1188783541"
variation 9379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923894"
variation 9380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:369522490"
variation 9385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923987"
variation 9390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:923494918"
variation 9391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477460562"
variation 9392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317790452"
variation 9395..9396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1645924240"
variation 9395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924190"
variation 9397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:369678188"
variation 9399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645924382"
variation 9399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924334"
variation 9400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750425416"
variation 9402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:932276397"
variation 9406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399655616"
variation 9412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645924654"
variation 9412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924616"
variation 9414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:910853352"
variation 9419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730433"
variation 9420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:536927360"
variation 9422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:566794455"
variation 9425..9426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1645924872"
variation 9426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645924925"
variation 9433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924976"
variation 9434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339261076"
variation 9436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1209679291"
variation 9437..9443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagttaa"
/db_xref="dbSNP:1645925240"
variation 9437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:942092258"
variation 9441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645925297"
variation 9442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925351"
variation 9446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1233011649"
variation 9447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645925450"
variation 9452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235883822"
variation 9456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631171"
variation 9459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254587948"
variation 9460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963726070"
variation 9461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925755"
variation 9462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1211791579"
variation 9464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925844"
variation 9465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645925905"
variation 9468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976524051"
variation 9469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1285469149"
variation 9471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645926152"
variation 9472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487344556"
variation 9475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:922346450"
variation 9478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:929800092"
variation 9481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:527669622"
variation 9482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549237039"
variation 9484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197914771"
variation 9486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730478"
variation 9489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1392976578"
variation 9491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436265888"
variation 9503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173872939"
variation 9504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1359389680"
variation 9510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450967468"
variation 9511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1290064103"
variation 9512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781379128"
variation 9513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909814849"
variation 9515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299657367"
variation 9517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1373626613"
variation 9522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645927187"
variation 9525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185858553"
variation 9541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055697473"
variation 9543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661621"
variation 9544..9553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tccttc"
/replace="tccttccttc"
/db_xref="dbSNP:1218081256"
variation 9544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645927931"
variation 9545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1261319218"
variation 9547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631281"
variation 9550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:905089140"
variation 9554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645928288"
variation 9556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476784105"
variation 9558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928392"
variation 9559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1209153186"
variation 9560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1002154199"
variation 9564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250980066"
variation 9566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730511"
variation 9583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730512"
variation 9590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388910"
variation 9601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928633"
variation 9605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928670"
variation 9607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928707"
variation 9611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169625706"
variation 9612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631302"
variation 9616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928858"
variation 9617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928897"
variation 9618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:755404281"
variation 9621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379326027"
variation 9624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566124661"
variation 9630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906587405"
variation 9631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929464"
variation 9635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:957905671"
variation 9636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987936386"
variation 9639..9643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1324462378"
variation 9640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645929665"
variation 9643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397188131"
variation 9644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929760"
variation 9646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442134509"
variation 9648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308942244"
variation 9650..9661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcagaccccag"
/db_xref="dbSNP:1645929927"
variation 9652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388998"
variation 9656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020633272"
variation 9657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930068"
variation 9658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:537918276"
variation 9659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011597209"
variation 9661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645930333"
variation 9663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976807461"
variation 9665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415042054"
variation 9669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556344781"
variation 9671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930529"
variation 9672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930579"
variation 9674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930630"
variation 9676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645930675"
variation 9687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645930721"
variation 9694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:920968850"
variation 9695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:571457484"
variation 9696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1237268495"
variation 9698..9701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1479460493"
variation 9703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1178560312"
variation 9706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645931081"
variation 9708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1408159161"
variation 9710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422693027"
variation 9712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778071525"
variation 9719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:538991257"
variation 9722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931359"
variation 9724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1420696197"
variation 9731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462365726"
variation 9732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337824283"
variation 9734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976378557"
variation 9740..9742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1353108129"
variation 9741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931650"
variation 9743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:76228984"
variation 9752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645931822"
variation 9754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730618"
variation 9755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:909469542"
variation 9757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982632384"
variation 9758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932004"
variation 9763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389116"
variation 9764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932124"
variation 9765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413035460"
variation 9767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932222"
variation 9768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909731645"
variation 9770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932343"
variation 9773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932401"
variation 9776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1336859435"
variation 9778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932525"
variation 9779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941191309"
variation 9784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:571976877"
variation 9786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542631707"
variation 9787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554236559"
variation 9789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645932802"
variation 9793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218947869"
variation 9794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1276981531"
variation 9805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206225660"
variation 9806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:897878642"
variation 9807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949518256"
variation 9808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:76697094"
variation 9810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1185171901"
variation 9811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258936672"
variation 9814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645933368"
variation 9815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475855058"
variation 9816..9817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1170589272"
variation 9817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148730672"
variation 9817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645933797"
variation 9818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417868148"
variation 9819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389218"
variation 9823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:905225551"
variation 9829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002072883"
variation 9838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487381167"
variation 9840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934129"
variation 9841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1171506019"
variation 9842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934252"
variation 9844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934296"
variation 9845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:191561832"
variation 9848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:565124454"
variation 9851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934495"
variation 9860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356152831"
variation 9862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934617"
variation 9868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1242561591"
variation 9869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774855156"
variation 9870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020767569"
variation 9871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934928"
variation 9883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396694608"
variation 9884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:965488511"
variation 9885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:999541063"
variation 9886..9887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1273371065"
variation 9886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052452213"
variation 9889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1208267090"
variation 9891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645935320"
variation 9892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281928751"
variation 9894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935416"
variation 9899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:997980288"
variation 9907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645935522"
variation 9915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144839878"
variation 9917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935647"
variation 9923
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:953699800"
variation 9931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777902193"
variation 9938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645935888"
variation 9939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389337"
variation 9940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909436967"
variation 9944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936024"
variation 9950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730732"
variation 9951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936070"
variation 9954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746430497"
variation 9956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972205965"
variation 9958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936224"
variation 9959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424826706"
variation 9961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1433155202"
variation 9965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645936346"
variation 9966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936384"
variation 9971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299430009"
variation 9978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936481"
variation 9983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:964296465"
variation 9984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645936637"
variation 9984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:541373139"
variation 9985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567471178"
variation 9986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046513851"
variation 9989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645936800"
variation 9991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645936844"
variation 9992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:926702492"
variation 9994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936923"
variation 9995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343372432"
variation 9998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937979601"
variation 10000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645937054"
variation 10002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937090"
variation 10004..10012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tatatcata"
/db_xref="dbSNP:1645937128"
variation 10005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:772438156"
variation 10009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273415719"
variation 10010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937280"
variation 10012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951009828"
variation 10015..10016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645937390"
variation 10016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369976515"
variation 10017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937485"
variation 10019..10024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1373713883"
variation 10024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:183777566"
variation 10029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1235279035"
variation 10031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:893706036"
variation 10032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938031"
variation 10035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:879287028"
variation 10036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938135"
variation 10037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938178"
variation 10039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938223"
variation 10040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389448"
variation 10041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376685024"
variation 10042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285655950"
variation 10043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557631682"
variation 10046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1009468975"
variation 10049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775089595"
variation 10051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645938531"
variation 10052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938581"
variation 10053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351784476"
variation 10055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938762"
variation 10057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982558756"
variation 10058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042607221"
variation 10059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938928"
variation 10062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938968"
variation 10064..10070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1449247484"
variation 10068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450922295"
variation 10078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645939126"
variation 10081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1246555874"
variation 10082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939234"
variation 10084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452924763"
variation 10086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:186821250"
variation 10088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645939409"
variation 10090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:147529833"
variation 10092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389520"
variation 10094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939650"
variation 10100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645939724"
variation 10103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:901047433"
variation 10104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645940116"
variation 10105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645940165"
variation 10106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016676335"
variation 10107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571389534"
variation 10111..10116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1156913272"
variation 10112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454602683"
variation 10117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041723286"
variation 10120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402447345"
variation 10121..10124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1378038090"
variation 10121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:902424416"
variation 10123..10124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1455044342"
variation 10123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393521931"
variation 10124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1237809139"
variation 10125..10143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttttt"
/replace="ttttttttttttt"
/replace="ttttttttttttttt"
/replace="tttttttttttttttt"
/replace="ttttttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttttttttttttttttt
ttttttt"
/db_xref="dbSNP:rs56299314"
variation 10125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998430886"
variation 10126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1389444371"
variation 10127..10128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1253963572"
variation 10127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:991298321"
variation 10128..10129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941577"
variation 10128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941528"
variation 10129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941619"
variation 10130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1305799231"
variation 10131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437526799"
variation 10132..10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941836"
variation 10132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1324541265"
variation 10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941887"
variation 10135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1373639324"
variation 10138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442010437"
variation 10142..10143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645942085"
variation 10143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:915821854"
variation 10144..10145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1459750847"
variation 10144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334151702"
variation 10145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645942678"
variation 10146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645942899"
variation 10146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1241485762"
variation 10147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730886"
variation 10151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730888"
variation 10153..10161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ataata"
/replace="ataataata"
/db_xref="dbSNP:1390527072"
variation 10162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326405001"
variation 10164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730897"
variation 10169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571389709"
variation 10170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389716"
variation 10172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730909"
variation 10175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192178564"
variation 10180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:76010229"
variation 10181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292086954"
variation 10183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730920"
variation 10188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645943470"
variation 10189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333357254"
variation 10191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:368787742"
variation 10192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645943653"
variation 10195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274276173"
variation 10196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1339109894"
variation 10202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274900715"
variation 10206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:571547232"
variation 10209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645943980"
variation 10215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389776"
variation 10217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438572134"
variation 10222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631973"
variation 10224..10228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tc"
/replace="tcctc"
/db_xref="dbSNP:1645944220"
variation 10224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468870902"
variation 10225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:927991002"
variation 10226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944341"
variation 10229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645944393"
variation 10232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645944429"
variation 10234..10238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/db_xref="dbSNP:2148730948"
variation 10237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1197725041"
variation 10239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730952"
variation 10241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389812"
variation 10242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953944035"
variation 10247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1236172183"
variation 10248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645944711"
variation 10249..10252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:935320290"
variation 10251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944817"
variation 10252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944852"
variation 10256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944915"
variation 10257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005197104"
variation 10258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1418357887"
variation 10261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945036"
variation 10267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052981048"
variation 10269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1165885221"
variation 10274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645945167"
variation 10276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:893885209"
variation 10280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538830586"
variation 10283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:554046305"
variation 10286..10290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:1039846959"
variation 10288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417210514"
variation 10291..10297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gag"
/replace="gagtgag"
/db_xref="dbSNP:1166468590"
variation 10291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645945523"
variation 10300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397247151"
variation 10302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1016631003"
variation 10307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:79355955"
variation 10312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374567306"
variation 10314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:998463302"
variation 10315..10323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtttg"
/replace="gtttgtttg"
/db_xref="dbSNP:1645945883"
variation 10317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1253380792"
variation 10318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945999"
variation 10319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972340698"
variation 10328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1210421637"
variation 10329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278367992"
variation 10333..10337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aagta"
/db_xref="dbSNP:1645946188"
variation 10334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486676421"
variation 10341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730998"
variation 10346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029907759"
variation 10347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256800555"
variation 10350..10353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttt"
/db_xref="dbSNP:1427805956"
variation 10355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1190759460"
variation 10357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331051161"
variation 10361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:886809352"
variation 10362..10364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148731008"
variation 10363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449770932"
variation 10366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645946697"
variation 10367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389968"
variation 10373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1172599437"
variation 10374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537611630"
variation 10376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1393337895"
variation 10379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1017098420"
variation 10381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1329859133"
variation 10382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:962457507"
variation 10392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298262217"
variation 10393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947152"
variation 10397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:970880807"
variation 10398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:796216640"
variation 10401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991745125"
variation 10402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022772857"
variation 10407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:926698779"
variation 10408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1211717696"
variation 10411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765055734"
variation 10415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947544"
variation 10416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231469789"
variation 10420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645947772"
variation 10423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:938122072"
variation 10425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947863"
variation 10426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947901"
variation 10427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:536504767"
variation 10432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645948019"
variation 10433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645948072"
variation 10436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1263636608"
variation 10440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:750161490"
variation 10442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645948761"
variation 10446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645948795"
variation 10447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1192727380"
variation 10449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645948898"
variation 10451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557632206"
variation 10454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645948999"
variation 10460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949043"
variation 10461..10467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagaaaa"
/db_xref="dbSNP:1392914826"
variation 10461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949105"
variation 10468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645949205"
variation 10469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:981350706"
variation 10470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1455253259"
variation 10471..10479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcat"
/replace="tcatttcat"
/db_xref="dbSNP:924520841"
variation 10475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915277531"
variation 10477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949519"
variation 10478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1452338087"
variation 10480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949661"
variation 10481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217983159"
variation 10486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291110926"
variation 10489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949803"
variation 10491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536507609"
variation 10494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1389902328"
variation 10495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440655487"
variation 10498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949979"
variation 10499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:555810167"
variation 10504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042270233"
variation 10512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950154"
variation 10514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901095268"
variation 10519..10524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttaatt"
/db_xref="dbSNP:1306471992"
variation 10520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998002982"
variation 10530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554734378"
variation 10532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950403"
variation 10533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262448321"
variation 10534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:889519470"
variation 10537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950528"
variation 10539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:761407670"
variation 10541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1005332944"
variation 10542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950670"
variation 10543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465261319"
variation 10544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574671804"
variation 10549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950821"
variation 10553..10554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:765710979"
variation 10553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:554554773"
variation 10562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:575943703"
variation 10564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645951006"
variation 10566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:543584812"
variation 10568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440347734"
variation 10572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645951162"
variation 10574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249253610"
variation 10577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1416767433"
variation 10579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:946799865"
variation 10580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040176474"
variation 10581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951426"
variation 10582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571390306"
variation 10585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:766182338"
variation 10588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645951578"
variation 10591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645951627"
variation 10597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:994240347"
variation 10601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1026532078"
variation 10602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:564774699"
variation 10603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951847"
variation 10609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934140536"
variation 10610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532140374"
variation 10611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645952015"
variation 10612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397122822"
variation 10615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752823385"
variation 10618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645952175"
variation 10624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475802643"
variation 10627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769579976"
variation 10629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051385703"
variation 10633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1387279727"
variation 10634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:887318250"
variation 10636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577137923"
variation 10642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731147"
variation 10644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952594"
variation 10646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390376"
variation 10647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952695"
variation 10649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952755"
variation 10653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571390379"
variation 10661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1329790878"
variation 10662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232591929"
variation 10664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952994"
variation 10665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016571419"
variation 10666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541247710"
variation 10669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221909151"
variation 10672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953212"
variation 10675..10678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1250436182"
variation 10676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170656511"
variation 10681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953349"
variation 10684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012690951"
variation 10687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731173"
variation 10694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034292694"
variation 10696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023122358"
variation 10698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953543"
variation 10699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1475198673"
variation 10701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645953620"
variation 10703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:959441747"
variation 10704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645953732"
variation 10708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971236523"
variation 10716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406344392"
variation 10717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390465"
variation 10718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731193"
variation 10722..10725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1170144354"
variation 10722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756201441"
variation 10723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571390483"
variation 10724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954035"
variation 10727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463669362"
variation 10731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308776284"
variation 10732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954194"
variation 10733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645954239"
variation 10737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:797000"
variation 10739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1413202362"
variation 10740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1314800058"
variation 10743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1356235775"
variation 10744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645954749"
variation 10744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291336086"
variation 10745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399312246"
variation 10748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1381191391"
variation 10751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645954902"
variation 10753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293434777"
variation 10757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955000"
variation 10773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955058"
variation 10775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1271937511"
variation 10782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305415314"
variation 10787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955199"
variation 10788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:149973488"
variation 10789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955307"
variation 10791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1274815717"
variation 10797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978512280"
variation 10801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1485047376"
variation 10805..10810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atcatc"
/db_xref="dbSNP:988567911"
variation 10807..10814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catc"
/replace="catccatc"
/db_xref="dbSNP:1645955559"
variation 10808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955621"
variation 10809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645955670"
variation 10812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260272129"
variation 10818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731236"
variation 10819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473376114"
variation 10822..10823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645955865"
variation 10824..10831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttagatta"
/db_xref="dbSNP:915270251"
variation 10826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1417796906"
variation 10834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731249"
variation 10836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956028"
variation 10837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956083"
variation 10840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922523004"
variation 10850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:933923210"
variation 10851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049564838"
variation 10854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255212265"
variation 10859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390632"
variation 10862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345239585"
variation 10867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956465"
variation 10868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374976353"
variation 10870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956563"
variation 10872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956616"
variation 10876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956654"
variation 10884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956696"
variation 10890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956744"
variation 10893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1432963371"
variation 10899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632608"
variation 10901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956893"
variation 10904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731274"
variation 10906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956933"
variation 10907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956974"
variation 10910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:749591113"
variation 10911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957080"
variation 10918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957267"
variation 10919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314784229"
variation 10929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541709462"
variation 10932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645957439"
variation 10933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645957482"
variation 10934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360833545"
variation 10937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:889656691"
variation 10938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:975558464"
variation 10940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269434140"
variation 10941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645957713"
variation 10944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:941085179"
variation 10946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957762"
variation 10947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:370987082"
variation 10951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645957861"
variation 10957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557632654"
variation 10958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:561377490"
variation 10959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645958029"
variation 10961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958078"
variation 10966..10969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1212627138"
variation 10968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958200"
variation 10970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230227545"
variation 10977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557632676"
variation 10978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1038086877"
variation 10979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958411"
variation 10985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1297912830"
variation 10987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1346659954"
variation 10988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231450945"
variation 10990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:896914475"
variation 10993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1281771883"
variation 10996..11001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645958717"
variation 11004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958777"
variation 11009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1257578153"
variation 11011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215700811"
variation 11016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:531586139"
variation 11017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958969"
variation 11019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757525458"
variation 11020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487708249"
variation 11026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487039969"
variation 11034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390780"
variation 11036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72902981"
variation 11039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1260188111"
variation 11041..11049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttttatatt"
/db_xref="dbSNP:934150347"
variation 11041..11044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645959570"
variation 11046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645959687"
variation 11050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645959736"
variation 11051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175609979"
variation 11052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425938053"
variation 11058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645959918"
variation 11061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051230848"
variation 11062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960017"
variation 11070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317511757"
variation 11076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906771930"
variation 11078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1040157330"
variation 11081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731364"
variation 11082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1437053986"
variation 11086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940262733"
variation 11089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960401"
variation 11090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1171516285"
variation 11095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1231609646"
variation 11099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960576"
variation 11101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:183246331"
variation 11103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148731378"
variation 11104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1033807276"
variation 11106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960749"
variation 11111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960818"
variation 11113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960867"
variation 11115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645960923"
variation 11116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223766443"
variation 11117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:959493286"
variation 11119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282794742"
variation 11122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1331785007"
variation 11126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565061414"
variation 11127..11130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggtg"
/replace="ggtggtg"
/db_xref="dbSNP:1433070917"
variation 11132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961260"
variation 11136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961306"
variation 11142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731402"
variation 11143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252699110"
variation 11149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:989617154"
variation 11151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324155466"
variation 11152..11154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:35360401"
variation 11155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022309525"
variation 11156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247403885"
variation 11157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645961677"
variation 11158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961719"
variation 11159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1469669349"
variation 11160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645961803"
variation 11162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:966786785"
variation 11164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961931"
variation 11166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961981"
variation 11168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:978102549"
variation 11169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458699622"
variation 11171..11183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcagttgctctc"
/replace="ctcagttgctctcagttgctctc"
/db_xref="dbSNP:932315942"
variation 11173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772665781"
variation 11174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645962253"
variation 11177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438311565"
variation 11181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962360"
variation 11184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331275123"
variation 11186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645962442"
variation 11187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731442"
variation 11191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440877349"
variation 11194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645962519"
variation 11198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962556"
variation 11199..11203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1645962608"
variation 11201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645962698"
variation 11201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:933913300"
variation 11206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1277194365"
variation 11207..11208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tata"
/db_xref="dbSNP:1645962827"
variation 11207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1352880263"
variation 11210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229529982"
variation 11211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645962916"
variation 11213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:985818181"
variation 11216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780359581"
variation 11219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645963039"
variation 11222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532437523"
variation 11223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1333104450"
variation 11224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941138142"
variation 11226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963237"
variation 11229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547982368"
variation 11232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963342"
variation 11235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963392"
variation 11237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290902326"
variation 11238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373686806"
variation 11241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179771257"
variation 11243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963572"
variation 11245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963634"
variation 11246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1254058861"
variation 11247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1473570625"
variation 11248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645963769"
variation 11249..11255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataata"
/db_xref="dbSNP:1645963806"
variation 11250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:929744265"
variation 11253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1368577431"
variation 11257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963949"
variation 11258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964002"
variation 11260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342960689"
variation 11261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1236022849"
variation 11263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391071"
variation 11265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645964181"
variation 11266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955855642"
variation 11267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964273"
variation 11271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280679964"
variation 11272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391096"
variation 11274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011523316"
variation 11276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964460"
variation 11279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964497"
variation 11283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566097843"
variation 11287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351790848"
variation 11289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645964638"
variation 11291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964690"
variation 11293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964746"
variation 11297..11307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgacttactg"
/db_xref="dbSNP:1557632990"
variation 11302..11304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tta"
/db_xref="dbSNP:1411012960"
variation 11304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964884"
variation 11307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964938"
variation 11309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632999"
variation 11314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968116522"
variation 11316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1262009984"
variation 11317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537000935"
variation 11326..11328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1487119334"
variation 11326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645965170"
variation 11330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548591833"
variation 11331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:569703352"
variation 11332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965386"
variation 11335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955413619"
variation 11339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965488"
variation 11342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965534"
variation 11343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965587"
variation 11344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001213093"
variation 11345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276915536"
variation 11346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:751069758"
variation 11347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537024441"
variation 11348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1055271617"
variation 11349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210193915"
variation 11350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965962"
variation 11353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256753454"
variation 11357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895417653"
variation 11359..11371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcactgagtatt"
/replace="tgcactgagtattgcactgagtatt"
/db_xref="dbSNP:1195903376"
variation 11359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011008122"
variation 11363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:986984923"
variation 11364..11368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgagt"
/db_xref="dbSNP:1645966287"
variation 11367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645966332"
variation 11368..11372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tattt"
/db_xref="dbSNP:1645966383"
variation 11372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368812370"
variation 11382..11383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:768505111"
variation 11384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:908733349"
variation 11394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1022445034"
variation 11397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940169695"
variation 11398..11399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1429852086"
variation 11398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966696"
variation 11403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645966780"
variation 11404..11409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="atcttt"
/db_xref="dbSNP:1645966820"
variation 11406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645966871"
variation 11407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966935"
variation 11414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038648489"
variation 11417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967015"
variation 11420..11426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="acttact"
/db_xref="dbSNP:1439339547"
variation 11421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:920167348"
variation 11422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:558557808"
variation 11426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454227670"
variation 11427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967251"
variation 11428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1335354894"
variation 11432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645967331"
variation 11433..11436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="atat"
/db_xref="dbSNP:760214668"
variation 11433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:577028704"
variation 11434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967498"
variation 11435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967559"
variation 11439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292926775"
variation 11441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1233660586"
variation 11443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967686"
variation 11445..11447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645967724"
variation 11446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747536325"
variation 11450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:534379333"
variation 11463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000050388"
variation 11466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967961"
variation 11468..11475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttgtt"
/replace="ttgttgtt"
/db_xref="dbSNP:774358868"
variation 11483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645968060"
variation 11485..11488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gt"
/replace="gtgt"
/db_xref="dbSNP:1482267019"
variation 11486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:906981995"
variation 11489..11495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctc"
/replace="ctcactc"
/db_xref="dbSNP:1645968230"
variation 11490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002603071"
variation 11493..11496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1392008923"
variation 11501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442744285"
variation 11504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1029659910"
variation 11508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391359"
variation 11509..11510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1449640571"
variation 11514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968581"
variation 11515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172540728"
variation 11519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645968854"
variation 11521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375424872"
variation 11522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968957"
variation 11523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891663260"
variation 11526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645969054"
variation 11527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955516294"
variation 11528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:13374690"
variation 11529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:186500181"
variation 11530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761501941"
variation 11534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021545390"
variation 11537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1366214165"
variation 11540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645969491"
variation 11543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900384495"
variation 11545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1301418755"
variation 11546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391431"
variation 11548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969750"
variation 11549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645969790"
variation 11553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313994790"
variation 11554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:962637582"
variation 11556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969978"
variation 11558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970022"
variation 11560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973883790"
variation 11564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731634"
variation 11565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256538396"
variation 11566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1349816459"
variation 11570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1308492815"
variation 11575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249913556"
variation 11577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996864302"
variation 11578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970400"
variation 11580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645970455"
variation 11581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249649614"
variation 11586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970856"
variation 11591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542145695"
variation 11592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970961"
variation 11603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971016"
variation 11604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971074"
variation 11605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:563417423"
variation 11606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773087620"
variation 11610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971253"
variation 11616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:576054752"
variation 11620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971355"
variation 11621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971407"
variation 11624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:543429815"
variation 11625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1215887950"
variation 11628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1176111045"
variation 11629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391522"
variation 11630..11639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaaaaa"
/replace="aaaaaaaaaa"
/replace="aaaaaaaaaaa"
/db_xref="dbSNP:148090796"
variation 11630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928413251"
variation 11639..11640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1571391534"
variation 11639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:191452426"
variation 11640..11647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/db_xref="dbSNP:1015679361"
variation 11640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:182527149"
variation 11641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972168"
variation 11642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1369938681"
variation 11645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:974606597"
variation 11646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1387455843"
variation 11649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972514"
variation 11651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645972635"
variation 11652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645972708"
variation 11657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:145217568"
variation 11658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:565342652"
variation 11659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645973107"
variation 11663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980305904"
variation 11664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043862956"
variation 11668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902717828"
variation 11669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329582447"
variation 11677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645973519"
variation 11679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999700616"
variation 11680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928334836"
variation 11681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1419816438"
variation 11685..11690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctct"
/replace="ctctct"
/db_xref="dbSNP:1645974053"
variation 11686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1164176522"
variation 11697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415503827"
variation 11698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645974332"
variation 11701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471932731"
variation 11703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:938344896"
variation 11709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376645263"
variation 11710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:188384146"
variation 11711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548893620"
variation 11715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006870978"
variation 11716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299599273"
variation 11719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731724"
variation 11720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1297748652"
variation 11722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975152"
variation 11725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368752337"
variation 11726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:947249893"
variation 11733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975310"
variation 11734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975356"
variation 11739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192876785"
variation 11743..11747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cataa"
/replace="cataattccataattccataa"
/db_xref="dbSNP:1645975465"
variation 11746..11759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagccac"
/replace="aagccacaagccac"
/db_xref="dbSNP:369200119"
variation 11746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232464621"
variation 11750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975673"
variation 11752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:996060361"
variation 11753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975778"
variation 11754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975833"
variation 11755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:962606885"
variation 11759..11781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgggcccagcctcttttacctg"
/db_xref="dbSNP:1645975920"
variation 11760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975972"
variation 11762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323198939"
variation 11763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571391707"
variation 11767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1221838658"
variation 11767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1030240996"
variation 11768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645976236"
variation 11769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891165367"
variation 11770..11773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:2148731754"
variation 11772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:570383674"
variation 11774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645976445"
variation 11775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1475127738"
variation 11776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015678868"
variation 11778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391747"
variation 11785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731770"
variation 11789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571391757"
variation 11790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1437672957"
variation 11800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557633486"
variation 11801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424657866"
variation 11812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1169982834"
variation 11816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:918514248"
variation 11818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431744049"
variation 11820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1308645978"
variation 11820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951256614"
variation 11821..11822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="agg"
/db_xref="dbSNP:1645977129"
variation 11821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:981312528"
variation 11823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977184"
variation 11825..11828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1645977241"
variation 11828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300930716"
variation 11830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977370"
variation 11833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977428"
variation 11837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381025451"
variation 11840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:928351968"
variation 11851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645977573"
variation 11852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228577338"
variation 11852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645977661"
variation 11853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753949706"
variation 11855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:937117617"
variation 11856..11859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645977831"
variation 11858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977865"
variation 11862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339586279"
variation 11865..11867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1645977959"
variation 11874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645978012"
variation 11875..11876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645978071"
variation 11884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1229978878"
variation 11885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481089017"
variation 11887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391859"
variation 11888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485670167"
variation 11895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978364"
variation 11896..11899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1208604089"
variation 11900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391875"
variation 11906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978528"
variation 11908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239632219"
variation 11911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978639"
variation 11913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645978711"
variation 11919..11922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645978750"
variation 11921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391892"
variation 11925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978883"
variation 11926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978962"
variation 11928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979016"
variation 11931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979058"
variation 11934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979099"
variation 11936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1055378139"
variation 11940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187262885"
variation 11941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914270513"
variation 11942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:946964831"
variation 11950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979475"
variation 11951..11956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1476134044"
variation 11951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979511"
variation 11960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979626"
variation 11962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1043914988"
variation 11963..11964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ta"
/db_xref="dbSNP:1645979734"
variation 11968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645979785"
variation 11970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391932"
variation 11971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979859"
variation 11972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391941"
variation 11975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979951"
variation 11977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980009"
variation 11979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980093"
variation 11982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902770990"
variation 11983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027592148"
variation 11985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980281"
variation 11991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185134170"
variation 12003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645980422"
variation 12005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173836103"
variation 12009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360773338"
variation 12013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552211427"
variation 12015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:570414684"
variation 12017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980706"
variation 12019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:190068140"
variation 12026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172290343"
variation 12027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757576530"
variation 12028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981388"
variation 12032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:938353158"
variation 12038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1007008303"
variation 12043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018285710"
variation 12044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149163525"
variation 12045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645981704"
variation 12047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:912995495"
variation 12048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310507008"
variation 12052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1356863618"
variation 12056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981907"
variation 12061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1313235178"
variation 12066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982028"
variation 12080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:898460552"
variation 12086..12095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttctt"
/replace="tttctttctt"
/db_xref="dbSNP:1246563466"
variation 12089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:193204277"
variation 12097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042793716"
variation 12099..12125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaacaaccagtgtcaccaggtatgag"
/replace="agaacaaccagtgtcaccaggtatgagaacaaccagtgtcaccaggta
tgag"
/db_xref="dbSNP:1339311810"
variation 12103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477092800"
variation 12105..12118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="accag"
/replace="accagtgtcaccag"
/db_xref="dbSNP:1213116304"
variation 12107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427185544"
variation 12109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771887940"
variation 12114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1308271391"
variation 12115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571392090"
variation 12118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210499147"
variation 12119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:900361502"
variation 12121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731916"
variation 12123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645982854"
variation 12126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982902"
variation 12129..12132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645982951"
variation 12130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645983009"
variation 12132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1386145677"
variation 12138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1255478039"
variation 12145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645983185"
variation 12147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320837542"
variation 12153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1330109319"
variation 12165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433685241"
variation 12167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1486733663"
variation 12168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368992746"
variation 12169..12179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atttatt"
/replace="atttatttatt"
/db_xref="dbSNP:1557633790"
variation 12173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645983564"
variation 12180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228316139"
variation 12181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267078324"
variation 12182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867210431"
variation 12183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:535270883"
variation 12189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731956"
variation 12191..12192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:2148731957"
variation 12193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:556704991"
variation 12196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266666866"
variation 12197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995516199"
variation 12198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143723018"
variation 12207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027816144"
variation 12208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645984324"
variation 12209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184939951"
variation 12215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564988943"
variation 12221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645984513"
variation 12222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037409376"
variation 12223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:897137584"
variation 12225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645984671"
variation 12226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1478352732"
variation 12229..12230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:1645984799"
variation 12231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433687798"
variation 12232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645984944"
variation 12236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958443914"
variation 12237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985054"
variation 12238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991235686"
variation 12239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1409603894"
variation 12239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473468758"
variation 12247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1159541645"
variation 12248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996026993"
variation 12252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:548438182"
variation 12254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985441"
variation 12259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:947018571"
variation 12260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434722116"
variation 12261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392261"
variation 12266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645985663"
variation 12267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349919648"
variation 12269..12276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taagataa"
/db_xref="dbSNP:755974130"
variation 12272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977126034"
variation 12275..12284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aat"
/replace="aatacccaat"
/db_xref="dbSNP:1645985908"
variation 12275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985847"
variation 12279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985973"
variation 12283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001619664"
variation 12287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:550918434"
variation 12288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645986209"
variation 12290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986255"
variation 12297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1229399720"
variation 12300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283911043"
variation 12304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263839"
variation 12308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051688201"
variation 12311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891328088"
variation 12314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986782"
variation 12317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780701723"
variation 12318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986930"
variation 12320..12322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645987003"
variation 12321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146481099"
variation 12332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249536680"
variation 12333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278385240"
variation 12334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645987953"
variation 12336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350343925"
variation 12339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645988075"
variation 12340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968398401"
variation 12346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:559571643"
variation 12350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645988275"
variation 12352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995485036"
variation 12356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414006163"
variation 12357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645988661"
variation 12364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645988724"
variation 12365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445175870"
variation 12367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1305566237"
variation 12373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1372959969"
variation 12374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217920228"
variation 12375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333997978"
variation 12377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989073"
variation 12383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025669719"
variation 12388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989207"
variation 12392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645989264"
variation 12405..12409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcttt"
/db_xref="dbSNP:1645989313"
variation 12407..12409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1242470958"
variation 12407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247378787"
variation 12413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1453640010"
variation 12414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989501"
variation 12418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392461"
variation 12419..12424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645989615"
variation 12420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989673"
variation 12426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921698461"
variation 12434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1191519402"
variation 12437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:887014334"
variation 12438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645989900"
variation 12439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989950"
variation 12441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533887056"
variation 12442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:530183670"
variation 12446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276852075"
variation 12451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344318585"
variation 12455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990366"
variation 12460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002828799"
variation 12461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645990508"
variation 12462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035927223"
variation 12464..12466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1396447344"
variation 12464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:958491341"
variation 12468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1440503374"
variation 12469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1454463169"
variation 12470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990826"
variation 12473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990904"
variation 12476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157441159"
variation 12481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991020"
variation 12486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1243379749"
variation 12489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991123"
variation 12501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051559876"
variation 12505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166236015"
variation 12506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391478845"
variation 12508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991327"
variation 12517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769437079"
variation 12522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1382205794"
variation 12525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021299293"
variation 12529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320931704"
variation 12533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400641517"
variation 12534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991632"
variation 12537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1390026558"
variation 12539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940563221"
variation 12541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:772679199"
variation 12543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991938"
variation 12554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645991998"
variation 12555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992071"
variation 12559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301734060"
variation 12561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542071503"
variation 12563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:140969609"
variation 12569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645992325"
variation 12574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645992383"
variation 12577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992429"
variation 12578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992477"
variation 12579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:924330559"
variation 12580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255367362"
variation 12582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342701448"
variation 12583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935573817"
variation 12585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732198"
variation 12587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1279007528"
variation 12591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987031222"
variation 12592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263511842"
variation 12598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992926"
variation 12601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:61588338"
variation 12604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645993120"
variation 12606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993181"
variation 12607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762650705"
variation 12608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151209493"
variation 12610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:3185860"
variation 12611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645993405"
variation 12612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:617254"
variation 12616..12623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctattct"
/replace="tctattctattct"
/db_xref="dbSNP:1645993556"
variation 12619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:546851825"
variation 12623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1047496021"
variation 12625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993755"
variation 12632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887152481"
variation 12635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993882"
variation 12637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528057622"
variation 12640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254691093"
variation 12645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994114"
variation 12649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994175"
variation 12653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1322836145"
variation 12661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468625617"
variation 12662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546700653"
variation 12664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994690"
variation 12666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994738"
variation 12673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1035797650"
variation 12674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148732262"
variation 12677..12680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1329329536"
variation 12680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1057016314"
variation 12681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774166730"
variation 12685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894411906"
variation 12690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328197100"
variation 12694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:617673"
variation 12702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995262"
variation 12704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767517357"
variation 12707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995367"
variation 12711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645995429"
variation 12713..12714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1571392793"
variation 12713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269631761"
variation 12715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021438273"
variation 12717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470842580"
variation 12722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:968427356"
variation 12723..12724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645995834"
variation 12723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1158659180"
variation 12724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538220647"
variation 12725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645995946"
variation 12733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148732301"
variation 12739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:998649331"
variation 12740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1208787348"
variation 12741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645996125"
variation 12746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732312"
variation 12758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1264651380"
variation 12758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645996176"
variation 12759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996290"
variation 12762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645996337"
variation 12763..12767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gagga"
/db_xref="dbSNP:2148732324"
variation 12763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435467966"
variation 12765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031750925"
regulatory 12767..12772
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: ATTAAA"
variation 12770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1461411805"
variation 12779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645996576"
variation 12782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411815515"
variation 12786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1471831102"
variation 12787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161741391"
variation 12788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010933207"
polyA_site 12790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="major polyA site"
variation 12790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954369519"
variation 12791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:535494736"
variation 12793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996920"
variation 12794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397201950"
variation 12802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997025"
variation 12807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291927465"
variation 12808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997119"
variation 12810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556743507"
variation 12813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:912794404"
variation 12818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:568710793"
variation 12819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328509541"
variation 12829..12830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645997459"
variation 12830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1349724926"
variation 12831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997560"
variation 12832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997604"
variation 12837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997657"
variation 12838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:964311587"
variation 12841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997748"
variation 12846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:975565048"
variation 12851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645997839"
variation 12852..12856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1289970722"
variation 12852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:920123616"
variation 12853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:931383205"
variation 12854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998053"
variation 12856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317214475"
variation 12857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998148"
variation 12858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921685638"
variation 12861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263224418"
variation 12862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998386"
variation 12864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998430"
variation 12868..12878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaagaa"
/replace="aagaagaagaa"
/db_xref="dbSNP:1489191079"
variation 12871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047104846"
variation 12878..12884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aag"
/replace="aagtaag"
/db_xref="dbSNP:953077202"
variation 12878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1482325926"
variation 12881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:987319587"
variation 12882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998748"
variation 12897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:908631026"
variation 12906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1423500069"
variation 12911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645998885"
variation 12915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998944"
variation 12917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334020336"
variation 12918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732424"
variation 12923..12928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgttt"
/db_xref="dbSNP:1425388438"
variation 12923..12927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:551871231"
variation 12926..12928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1571393013"
variation 12927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645999245"
variation 12930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307434820"
variation 12934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:754003469"
variation 12937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911758811"
variation 12938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763435450"
variation 12942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373764064"
variation 12947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:894380672"
variation 12949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:11803162"
variation 12950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1323075098"
variation 12954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393070"
variation 12956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645999839"
variation 12960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1195017326"
variation 12968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557614640"
variation 12972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340744989"
variation 12974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207879034"
variation 12975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233865788"
variation 12978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000122"
variation 12980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000167"
variation 12983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646000219"
variation 12986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1483140763"
variation 12987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188246113"
variation 12991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180440137"
variation 12996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000397"
variation 12997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1258548504"
variation 13000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646000491"
variation 13010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000550"
variation 13017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445453595"
variation 13020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388370039"
variation 13028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1427799237"
variation 13030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646001427"
variation 13031..13032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1646001486"
variation 13033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172476848"
variation 13040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646001597"
variation 13041..13045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1465366528"
variation 13041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300800227"
variation 13042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646001729"
variation 13044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1384613036"
variation 13048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765512570"
variation 13052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296280568"
variation 13053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646001941"
variation 13064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:999103079"
variation 13067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1031390116"
variation 13069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1274361357"
variation 13072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312064304"
variation 13080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048361259"
variation 13086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:954633333"
variation 13097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008543100"
variation 13102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1646002395"
variation 13102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002331"
variation 13105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258131628"
variation 13111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732519"
variation 13114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646002496"
variation 13115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002562"
variation 13116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646002643"
variation 13117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1461969099"
variation 13121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002723"
variation 13131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002777"
variation 13132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750676879"
variation 13136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372215826"
variation 13141..13146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agatag"
/replace="agatagatag"
/db_xref="dbSNP:747128678"
variation 13141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246372871"
variation 13142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646003040"
variation 13144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:541089374"
variation 13146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420464265"
variation 13152..13154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1458669625"
variation 13156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420152307"
variation 13158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:975699442"
variation 13161..13164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1646003844"
variation 13165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:920175823"
variation 13168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1407985565"
variation 13172..13177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:879476871"
variation 13173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:553296373"
variation 13175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:983370268"
variation 13179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166121037"
variation 13183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000280959"
variation 13185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646004353"
variation 13187..13188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1028638611"
variation 13188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393323"
variation 13189..13196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:537923747"
variation 13189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:908602603"
variation 13190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:181064431"
variation 13193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:542295369"
variation 13196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:563919064"
variation 13197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:112898338"
variation 13198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1480657929"
variation 13199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005279"
variation 13200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249438005"
variation 13213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1341003490"
variation 13215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005638"
variation 13218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948637090"
variation 13219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409385468"
variation 13224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042915926"
variation 13225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1318454112"
variation 13229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1348773393"
variation 13233..13240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atga"
/replace="atgaatga"
/replace="atgaatgaatga"
/db_xref="dbSNP:927327408"
variation 13237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346625871"
variation 13241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937333611"
variation 13244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546552052"
variation 13250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646006216"
variation 13253..13261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataaaata"
/db_xref="dbSNP:1646006249"
regulatory 13253..13258
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: AATAAA"
variation 13256..13259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1057183876"
variation 13256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006294"
variation 13257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1353187187"
variation 13260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895865063"
variation 13262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278971952"
variation 13270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113322531"
polyA_site 13275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
variation 13276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:751968895"
variation 13281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1041857755"
variation 13282..13284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1490476437"
variation 13283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260154197"
variation 13284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006975"
variation 13285..13292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tatt"
/replace="tatttatt"
/db_xref="dbSNP:1181268134"
variation 13285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409449668"
variation 13287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556209808"
variation 13288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007200"
variation 13291..13292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1158810267"
variation 13294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1412573968"
variation 13296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646007375"
variation 13302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890196881"
variation 13306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164876514"
variation 13309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366804179"
variation 13314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000473891"
variation 13315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646007686"
variation 13316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007746"
variation 13318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528752687"
variation 13323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371743303"
variation 13324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732668"
variation 13328..13333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1646007997"
variation 13328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1337878891"
variation 13329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008067"
variation 13333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017276949"
variation 13336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646008138"
variation 13340..13346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agta"
/replace="agtagta"
/db_xref="dbSNP:1571393515"
variation 13341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1646008232"
variation 13343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008319"
variation 13345..13355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taaataa"
/replace="taaataaataa"
/db_xref="dbSNP:1463701048"
variation 13348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283853555"
variation 13356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354426697"
variation 13358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008521"
variation 13359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008564"
variation 13363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008605"
variation 13369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008643"
variation 13370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1029234276"
variation 13371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008780"
variation 13381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360124812"
variation 13383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204324335"
variation 13388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:755507279"
variation 13391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:994515114"
variation 13391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1248268375"
variation 13397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1646009159"
variation 13400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009214"
variation 13402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439377406"
variation 13407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646009303"
variation 13413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027212716"
variation 13414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:150294351"
variation 13415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646009423"
variation 13417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732720"
variation 13419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375077345"
variation 13423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009514"
variation 13431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1471600869"
variation 13435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393572"
variation 13436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1184975862"
variation 13437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:137937874"
variation 13439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646009749"
variation 13441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018716062"
variation 13445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747667827"
variation 13446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557634949"
variation 13447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:972327090"
variation 13448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755634987"
variation 13449..13451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1333857852"
variation 13451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992913212"
variation 13452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027513323"
variation 13454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:866611493"
variation 13455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915999164"
variation 13456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393625"
variation 13457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315881943"
variation 13458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948694188"
variation 13459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951959518"
variation 13460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646010429"
variation 13461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:369177016"
variation 13462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1249546128"
variation 13463..13470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:926539078"
variation 13467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646010659"
variation 13471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646010719"
variation 13472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978750367"
variation 13473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1277644378"
variation 13475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646010976"
variation 13476..13484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggggtaggg"
/db_xref="dbSNP:1459736713"
variation 13476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:757440604"
variation 13477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011106"
variation 13478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011168"
variation 13481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:937345012"
variation 13486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011287"
variation 13489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011345"
variation 13490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732793"
variation 13491..13509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggagggtggagaagagag"
/replace="gggagggtggagaagagagggagggtggagaagagag"
/db_xref="dbSNP:1646011402"
variation 13495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646011442"
variation 13497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:992754289"
variation 13498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1557635040"
variation 13502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777335358"
variation 13503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011644"
variation 13504..13513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agagagag"
/replace="agagagagag"
/replace="agagagagagag"
/db_xref="dbSNP:917332610"
variation 13504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400487753"
variation 13505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052949107"
variation 13507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337672685"
variation 13508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042173951"
variation 13510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433002965"
variation 13511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890323189"
variation 13514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:944523722"
variation 13517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012268"
variation 13518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:926170271"
variation 13521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012396"
variation 13523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328194233"
variation 13527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228031040"
variation 13528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274083950"
variation 13529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1038766385"
variation 13530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:936153832"
variation 13533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646012670"
variation 13534..13537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1646012732"
variation 13538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646012802"
variation 13539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012848"
variation 13543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012914"
variation 13544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900268718"
variation 13546..13550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gctcc"
/db_xref="dbSNP:1646013091"
variation 13546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263381056"
variation 13550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646013169"
variation 13552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:994483877"
variation 13553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027759385"
variation 13555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1260081808"
variation 13558..13563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1430597782"
variation 13564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189626933"
variation 13567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:748935515"
variation 13568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646013928"
variation 13572..13573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1646013985"
variation 13573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646014059"
variation 13575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646014128"
variation 13576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393759"
variation 13577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888693143"
variation 13578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393772"
variation 13579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529029363"
variation 13582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550254208"
variation 13584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448127823"
variation 13588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198804497"
variation 13594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1452846937"
variation 13597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014790"
variation 13598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568745685"
variation 13599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:539225869"
variation 13600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481624921"
variation 13601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014975"
variation 13602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015038"
variation 13606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015106"
variation 13608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1177526516"
variation 13613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557502575"
variation 13614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008583388"
variation 13617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770599707"
variation 13618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566671117"
variation 13621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571393823"
variation 13624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290747057"
variation 13625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385739329"
variation 13627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992965566"
variation 13628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149480174"
variation 13631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359870567"
variation 13633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393854"
variation 13634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452955599"
variation 13635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372205273"
variation 13636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646016011"
variation 13637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283671820"
variation 13647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387050257"
variation 13648..13650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1328134606"
variation 13649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1236404859"
variation 13651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435466336"
variation 13653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:978718021"
variation 13654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993290863"
variation 13656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016404"
variation 13657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:925979776"
variation 13658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951950535"
variation 13661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732980"
variation 13664..13666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1646016530"
variation 13667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732983"
variation 13671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955978316"
variation 13673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016728"
variation 13674..13678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtgtg"
/db_xref="dbSNP:1490979203"
variation 13675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1200680347"
variation 13678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016843"
variation 13680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251501560"
variation 13681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989092655"
variation 13684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:145835702"
variation 13685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:138746703"
regulatory 13689..13694
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: ATTAAA"
variation 13689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960582832"
variation 13692..13694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaaa"
/db_xref="dbSNP:530985639"
variation 13695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017641"
variation 13698..13701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:150609292"
variation 13703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148733025"
variation 13705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557635273"
variation 13705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:967767747"
variation 13706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017835"
variation 13708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1303579430"
polyA_site 13712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
ORIGIN
actggcagctggccgggcgctcgcagtgggagctgctgcaggctccgcggcggcggcaacggaggctgcgggggcggcggcgcgagcggccgggcttggtaggggagccgagcccggcccgggatcccgagcagcgagagtgtggggtacctaggcccctcacgctggacttcacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcgggcgcttacctgccccccctgcagcaggtgttccaggcacctcgccggcctggcattggcactgtggggaaaccaatcaagctcctggccaattactttgaggtggacatccctaagatcgacgtgtaccactacgaggtggacatcaagccggataagtgtccccgtagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcctgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaacgaacgggtcgactttgaggtgacaatccctggggaagggaaggatcgaatctttaaggtctccatcaagtggctagccattgtgagctggcgaatgctgcatgaggccctggtcagcggccagatccctgttcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttttataaggcacagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgcgttcgcttcaccaaggagatcaagggcctgaaggtggaagtcacccactgtggacagatgaagaggaagtaccgcgtgtgtaatgttacccgtcgccctgctagccatcagacattccccttacagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccatctgccctgcctacaagttggccaggaacaaaagcatacctaccttcccctagaggtctgtaacattgtggctgggcagcgctgtattaaaaagctgaccgacaaccagacctcgaccatgataaaggccacagctagatccgctccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttgggatcaaagtgaaggatgacatgacggaggtgacagggcgagtgctgccggcgcccatcttgcagtacggcggccggaaccgggccattgccacacccaatcagggtgtctgggacatgcgggggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacagtgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcctatccagggtcaaccttgtttctgcaaatatgcacagggggcagacagcgtggagcctatgttccggcatctcaagaacacctactcagggctgcagctcattattgtcatcctgccagggaagacgccggtgtatgctgaggtgaaacgtgtcggagatacactcttgggaatggctacgcagtgtgtgcaggtgaagaacgtggtcaagacctcacctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgccgtttttcaacagccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgtgctactgtgcgggtacagcgaccacggcaagagatcattgaagacttgtcctacatggtgcgtgagctcctcatccaattctacaagtccacccgtttcaagcctacccgcatcatcttctaccgagatggggtgcctgaaggccagctaccccagatactccactatgagctactggccattcgtgatgcctgcatcaaactggaaaaggactaccagcctgggatcacttatattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaatgagcgaattgggaagagtggtaacatcccagctgggaccacagtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccagggcaccagccgaccatcccattactatgttctttgggatgacaaccgtttcacagcagatgagctccagatcctgacgtaccagctgtgccacacttacgtacgatgcacacgctctgtctctatcccagcacctgcctactatgcccgcctggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagaggggagccacatatcggggcagagcaatgggcgggacccccaggccctggccaaagccgtgcaggttcaccaggatactctgcgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccccaggagctgtgccacccaaatccagaggaagcaaggaggagggaggtggggtagggaggagtgtaggatgccttgtttccttctatagaggtggtgtaagagtggggaacagggccagcaagacagaccaccagccagaaatctctgatatcaacctcatgtcccccacccctcaccccatcttgtcacatctggccctgaccccactggaccaaaaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtaaggtcaactctgtagccctgcagacaaaagctggttaggtttgggtttgatactttagatgggaaagtgaggggcttgagaaagtgggtgggaggagggaaggattttttaggagccttaatcagaaaaggactagatttgtttaagaagaaaaatgaaaccagacccagatcaatattttaggatactagatgttttaatgggttcagaatccagtttgtaggaagattttttaatggttttggttgctcctcccccagctgccaccccccaccttacccttattcctctctgtccacattttctgccccaccttacttctcctccctgacagacatccagcccctagtaatacttaaggcactatggcacttagctttgaagtgacacgaccctgtcttccttccgcccgctggtgggtaaccagtgccttccctgtaacggtaatgctgcagaactgcaaccttttgtacctttctttggggaatggggtgggggtgggagaggaggtagatggggaagaaataccccagacccaacaaacctccagccagaaagccagctattttgcatttgaaggaattgacttcctcattcattgagctttttaaaagatcacaacctcaagatggttaaaatccattgacatttgcactttcaaacatgacaagtctcggagctgctgagatgacaggcccctggcctttccacttatgcctccttttctccttattcctcctacctcccgccccgcccaggtctggagttactttcatagcatttttcactcttggcttcttttctcccttgatggtcaagtctcttatgtttcaatatttcttaactggggtgtcttataacaaaaaactcttaggtctaaaatgagaaaaaagagagaaaacaaaatgttatttttataccataacttgagtgtattgccaaaatttggaaatccttcccatgcctgatgagtttatatcccagaaacattgagccatcagaatgaactgtgtacctgatttgttctctgacctggctaggtagggagggggtggttatcgccccaagatggggtccaggctccatccttcctctgtgcagataatacctttttcttgctatagcctccctcctctgcactgtcctgcactctttcttgcaagtgcatctttttccttcccctggactgtcctctgaccctttggctcatcctagattgcagtgtgtcctgtggacaggctggggaattttgctgctccctattgcttctgtttacaaaaatgaatttttcctggtttcccactagggcatgtgggtgggtggcatggacttttttttttttttttttttgtcttgagacatggggtttggctgtcttgcaggactggagaaggtggtggttctagcttggtctctgttggccttgaagcaagcatcccccctgccctttttccttgactgttcatttttttcctgccccactgcttgggatggggagttgcaacttcagtgtggaatttcctctttgaggagcctgggcttggatctatcctgatctggtgatgaagccatgattactttagacctagcccaggcttggaggccagctggaggaagaagggtctaaatcctggcctgtagagttagaactaccatttcctccccttagctgcccttgtatgacccggatttgctatgcaaaacaatctatcccaggttctgttctggttggctacattgttcagcaactcacaaaacgtagcacaaacattcattatggagaaagcatcaggactgttgagtaactcctcctttacttttttcctgctggctacagcatggggtgccctataggcacaagcccagctgaagaacagaatggagggctctgggaggaggcagctcactggagagcctacattccttacacaagtgcctaaagagagtgatgctaacactccatctgccctgtccattgccttcatatacagtctacttcgtgttctgtcaccctttggggaggggagttctcctgggacagtgggctctgcatgttctccacttggatacattttggggctaggatcagggcactattcctggagggtccagtcattcaccagcatttgcaaatgtccatagggagcaggtggcagcctctactcccagcaacaagtttgtgttctctccttttctctctttgcctcactctctccagttggttttcagctggggcttgaaatgcatttttagccctttgacgtggcttatgccattcaagaaataaaaagcaagagaatcagctttgggcaatgacaagaaatgagttcttactctgatttttttgtaaaaagataatttttgagacttgaaaaataccccgaccttgagattattcctgtttgaaaggtggtgcatgcagatggagaagtggtgttggcagcaagctttggctcatgtggatttggtttaagtggtgcttcttacccaagcttcaaggaagtgcttgggggacccccagcctcatcctcttagttgggtctcttgttccctttgtaccactgttttgccttccttttcctcttctctctttgcctggcttcctttcccttttcttctattcactctgcttgcttgctggccggcctgcctgcctgcctgcctgcctgcctgcctgtctgcctatgtgatgatgaaatctctgcatggctgcaatgatcccactgttagctggcagggtcaggcttagctccttgactgcagaagaccaagaacctgttccccaagcccagagatgtccacctgggctggactgccctcaagcttatactagagaagagcaactgacctgcccaacttgtgtgaagtcaggagggtttctggcattttccacacctgtccactccttggagctggtttctctcattgctttttctaaatctggttctttttctctttacctggggcctggcttttctgagattgtcttagggttgagctatttgggtatcctgggtttgagtgttaggggatggacataaaggaaaaagagtgatgagaagagaatggagagaatttgaataaaaggtgggaaaggagagcactgttctttgattgtttatccagtccaacctgatccattagggatcgaggtgctacactggcctccagggataagcctggggctactgttgctgggaacttaggcttaacataaagccgaagaaggtacctagaaatttgaaacttccctaaaaagctcctaatgcccacctgctagatagcttctctgtggcctcctatttagctaagcagcagtgtttttggatactttttttttctgtttgtgaataaggccagcactcaagatgggcagccaagggtgcactgactattagctggcccataggatatctgtaaggctggtgggacagttttggacctggaatcatgtgtaactaacaaggttggacgtttcttccccatcagggtagaaaaatcatctcaaactagccaaaaggcagttttggaaactacattgggggacgttatttttatttatatatggggcctaggccaatccaggatggtagctggaataccttccttcttaaaatctgatcatggcagggatatgcagggcactttttactatttggccttctaagcagattgggaaggaggtattttctggttttcgctttcctccgacttaataggacttgccttctccctgggcagggagagaggctgggttggtgctctcccttactctactcatactgacttagagcctctggctgctgtttgggcatccaagaaagggaggggaaggaatgagctaaaaacaaaacagaatgaggtgggaaagggagattttcttctttacagaggaaaataggaaaccctccaagaattgtgcaagtaaagacatttgttgaatgcactgagtcccttggtgtagtagcaataaggaaaaatgaaattactttcctgtgcacacagtccagcctaattggtatgtgatgttgcacttagcagccatgtggtgggcatgtgtgactactctggttttcactttagtttctaaactttttatccctctcaagtccagcatggatggggaaatgtctctggatccccacagctgtgtacttgtttgcatttgtttccctttgagatttgtgtttgtgtcctgctttgagctgtaccttgtccagtccattgtgaaattatcccagcagctgtaatgtacagttccttctgaagcaagcaacatcagcagcagcagcagcagcagcacaattctgtgttttataaagacaacagtggcttctatttctaaagtgcggtctttctctttttttttcctaccagcaaaacaaacttttgggactgattacatctctaatagattttaggtgagaataatactgtagattgttatgcaggaatacttcacagagccttcatttattcttcattcaacaaacatgcaaagcactgtgccagcagtattgtggggaggggaggcacaattcaaaatgaggaaaatagtgtccgtctcattaagggaattaagtttggtgggggatatgattagccaaatagtcccctggcataggaggaagataatgagggagtggaataaggctacaacaacgaatatagggaggaagggacagatttgagagacgaggtagaattaataggactcgatggctggtgggaggagaagacaggagtagaggttagctcccaggtttctccttgaccataggagtgtgttgggacattctgccagtcaagatgggggtgacggggagactgtagaaggaaggtggggagtttttgaagaaacagaatgttgtatagactgagttttgaggtgtttgtggggcagtaagggtaaggtgtccagtaaacacaggttggtgctcaggtaagactgtaaaactgcatttatagatacaggagtcttatagatggtagttaaagccataggcatgaatgagatagcttagaaaaagagaagagaaactagtatacagccccctaagaaactcaatttaaaggttcgggggaggaagcagatcttaaggtgacagatcactggtagacagtttgtgggttttttgtttctttgtttagccagtttggtgaggtaggagaagaaatcagagtagaagaaggttcatgaagggagtgattaacaacatgaactgctgcagagagggagttctttttttttctgtgtgttttacctttctactccccatcttttggggatcttgtaactctatgacttacttacgttattctccagtatttcttgaaaatgagcattggaaaaaccaattctaaaatggctaaaactaggactttcaagttcaccacaactaccaccaattaggagataattgtaaaagaataaacaaaacctaattttgttcctagccaatattataaaccatgttccagcatactagataatagtagcatactatatttatttccataatttgtcttctttagagcctatgaactcctaggagcagaagctatattctcttcatttttgtcatctcagggtcatggcatataccaacagatcagtatgtgcaaatataattgaaataggctagtagtctgtggtttatgagtatgggctgggtgggcagtggatcaagaagtgataggagtacacaggatgaactcagaattcctgaatcttcaggtaagcagatacttaactacattatcattgtcttttcccactcaccccaagttggaggttctatggttttgtactttaagctggtggtataattgtcaagcatgtaaattctggcattcttcctggtactgctagagcattgttatttctatgcatgggggtaagaaggctcagagaaggatcctggcggataccccagtgagaaatcgtcagtggcagccagtgtgtacatacgtggacctagcattcctctggaggccaagtgttgtaaattggcctgtggctatcatctggcagactcccttgggaaagagccagccagccccatgcttcttttcagcagcaagggttagggaggttggttgaacttgaagagcagattggacatggagcagattttgaccagttgaaataagacataaatttatgactccgagtgaggcagaaataaagaacttagcagggggaataggaggaggatgattatggcaaattttgctataaactttagttttagaaaagattgatattgaaaagccttcaggatttgcctgtggttgctactcaagttaaaaagactgggagcctgcattgtttggtcctggagctcaaggttttcagtgaaggcttgtcctggcacctctgggcattccttttcattactggttgagcatccttccttctgctctgtcaattggcaaaatatgctggagcacattctggactagcagttgccttggggtagtcaggctgggtatttgtttggtatctcttggtgtagcagaccccagaatctcatggcaattaggatttggtggctaaacgaaagagttagtgcaaggaaaagcctagttggaatttctgagtctgggccatccttaagctgctgtctactgcctgaatgggaagtaatgtcgaattggaaaattagctcaccatttttgttctagctttgcagacatttattcctctgatgataggctgagaaatgcctaggccggcttagaaggcacacagcatgacagaagtactccttcaaagcagctgtgtcaagaaggaagagctggaaaagtggatttgctggggaattagatgcatttagttttccacttacgcacaactgccttctccagtatatcataccaaggttttttaggcctttgtggcttaccctgcaggaacatactgtgtcctgttgttctggactgtagcatcttcaccaccatcctcttggcaatggttttttgtttggggtttttttttttttttttttggacaaagtataataatattgagggacctttctagggagcctttggtcctttgtccccattttccaaagggagggaactttcctcttaaaagagacagtgggaacttttagccaggtttttggaaaaggcctgtgggctattaatgagagtgagctgcaaaaggaggaagggtttgtttgggtactttgaagtacttagctaggtgttttctacagtatcttatataattgcatcttacagcatctttacatgcgaaatagtttatcagttatcttcaattgcatattacaaaattctgattaaatttttcttaaataagaaaactatcatttcatatgacaagaaatcctaatttaatgttactccaaggttggttaattcagtggctcagtgataacaccaaagactcagtttcttgaaatttttttgctctgccatcctccatgtttatcctcacgccagttcgcctcatggtcccaatatggctactgtaattctgggaaggaaatgctgacagaaccgtgtctggcaaaagagagacagatttttctgtgtccttctaaagcaaggaagtcttcccctggaagctccaacagatacggcctcatggctttgctagaaatgggtcatctcactcctgtcattggcaaagcaagtaagatcatccatcaggagtggcttagattaatgaattatcctttgagtcgtgtagactagaaagttcagtcatgtctactagcaagaaaggagataagggctgttggataagcagcatctggtctcaaaggtacttcaacttttacagatgagaaacatgaatcagagtgactttcccaggctcacagcaagtaagagagggccttcagtgttagctgtgtctgtccctaaagcccatgttttatattgtatcttgctagagtataaagtaacttactttctaccttgtagaaactgatggtctaggagaagagatttgaactcaggtgcccagttgactctaatcttggcccatgtgagaggattgtactcagttgctctcctcatccagtgatgtttcttgtctaacacaagaagcctaggagtagaaagtcctaagcagagtagaataatagcggcagcagggagggaagtgtgaactgtgtgtccctgagcctgacttactgggcagggacatgacacttaaagcggcagctggccactctgtctttcctgcatgcactgagtatttggtagctcattagtgaccagtgatattgatcatcttttcatgtgctcacttactatccccatatctttgttgtttgcatcttttacccattgtatttgttgtttttgagacagtgtctcactctgtcacccaggctggagtgcagtctcatgatcgcggctcactgcagtttctgcctcctgggctcaagcaatcctcccacctcagcctcctgagtagctgggcttacaggcgcacaccaccatgcccagctaattaaaaaaaaaattttttttgtagcagttcggtctcattagtattgcccaggctggcctctcttagcttcaagctatcctcccgcctcggcctcccaaagtgctggaattacaggcataagccacaagccactgggcccagcctcttttacctgtttcaaaattgagttttattgagttgtaagagttctttattcattttaaacacaagtcctttgttggatatatcttttacatctatttttcccagtctgtggcttgccttttcattttgaagagcaaaagtttaaaattttgtgaatttattaaagctccgtttgttgcttttttctgttctagtttatacttttgtatcatattttaggaaattttgcactgggtatttgatggctcctgaggaggttcaactttcagagcgcactgatttctctgcacctgagattttgtactatttctgtatttctttcttctcagaacaaccagtgtcaccaggtatgagggcagagttttagcttgtttgctgagccccattcttgaagctcatttatttattcacctatctgtccatcaatccaacaaatatactgaatgctgctatgtgccaggtactggcactgttctaggtactggggcaatgacagttaagataatacccaatgaccctgctctgtacccttaagagcagactcagttgggaatgagttatccaaatatagggtgtacatgtagtcaggagagagcctcatacagctttgcctttggcagaatccttcaaacctctttgtcttcctacttcttgatattacaaatcatgagcctttcacatgcattgactctaaagaggtgggttcctggatagcagaagtagataggaaggcatcattgacatttactgagatggattgaatcagagggtgtaaattctgctccatcaatgttgaaaaagactagcccaccccaaaggtttatcactgtcaccatgtctaatgtctattctggaagaagctgaagaagtctgcctttgtttagggaaccggttccagaatcagaggggttgaggatataaaagacccttgcacaagagttggtatttaccctgtcagatgctgctaccaagatttggattgtgtacagtcgaggattaaaaatgacttttaagatgcagtgtttcatctggtgacatttaatttgatattttaaaattggggagggtattttcagccatgggggtagggatgtgaaagaagaagaaagtaagaattggagtcagatgtggttttgagtcccatacatttattgtttaatattatatggtaagtactttaaaatggtaaatagtaaatacttgtgttattcactaacatttggggaggattttctctgtgctttatgtatattacctaaccttacaaactgtgtaaggtacatgctgttctctcaatttttcagataagaaaattgaagcccagagagatcaagtgactgatccaaagtcccacagtgaggggaactgaagataggatattctttctccttttcctctttaaaaaattattttgattaaaaaaaaccgtattactgaagcatagggacatggggagaaattatgaatgattcctcagcctgaataaaatagtatgtttcattaaggcaacaaatatttattaaggacctaatatttgcctgacattcaagtgaggtggggggcacacaagtagtaaataaataacagactgggcaaagggctaccaaggcaatactgtagtagactaacaggtgccccaccatagatgggtggtccggaaaaggcgtctcagatgtctttcgttgagacgcaaaaaaaagctgtggggtagggcgtaaggggagggtggagaagagagagagggttcctggccaagggaaccaaaagcagagaagctccaagtcagaaaaaagcagcggttggcccgttgggagaattggaagccaaccagtatagctgtagcacaggcggggcccatttacgccgtgcgttttcaccctggaaaggagtttgggttttcaagtgtgacgaggcgctattaaagagttttaaacatggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]