LOCUS       NM_001425285            5336 bp    mRNA    linear   PRI 08-NOV-2023
DEFINITION  Homo sapiens retrotransposon Gag like 1 (RTL1), transcript variant
            2, mRNA.
ACCESSION   NM_001425285 XM_047431358 XM_054376024
VERSION     NM_001425285.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5336)
  AUTHORS   Mahmoudi AR, Ghods R, Madjd Z, Abolhasani M, Saeednejad Zanjani L,
            Safaei M, Balaei Goli L, Vafaei S, Katouzian L, Soltanghoraei H,
            Shekarabi M and Zarnani AH.
  TITLE     Expression profiling of RTL1 in human breast cancer tissues and
            cell lines
  JOURNAL   Exp Mol Pathol 121, 104654 (2021)
   PUBMED   34087231
  REMARK    GeneRIF: Expression profiling of RTL1 in human breast cancer
            tissues and cell lines.
REFERENCE   2  (bases 1 to 5336)
  AUTHORS   Kitazawa M, Sutani A, Kaneko-Ishino T and Ishino F.
  TITLE     The role of eutherian-specific RTL1 in the nervous system and its
            implications for the Kagami-Ogata and Temple syndromes
  JOURNAL   Genes Cells 26 (3), 165-179 (2021)
   PUBMED   33484574
  REMARK    GeneRIF: The role of eutherian-specific RTL1 in the nervous system
            and its implications for the Kagami-Ogata and Temple syndromes.
REFERENCE   3  (bases 1 to 5336)
  AUTHORS   Prats-Puig A, Carreras-Badosa G, Bassols J, Cavelier P, Magret A,
            Sabench C, de Zegher F, Ibanez L, Feil R and Lopez-Bermejo A.
  TITLE     The placental imprinted DLK1-DIO3 domain: a new link to prenatal
            and postnatal growth in humans
  JOURNAL   Am J Obstet Gynecol 217 (3), 350 (2017)
   PUBMED   28502757
  REMARK    GeneRIF: We find that placental expression of DIO3 and RTL1)
            correlates with prenatal growth. Combined, these findings suggest
            that epigenetic programming and gene expression within the
            DLK1-DIO3 imprinted domain influence both prenatal and postnatal
            growth.
REFERENCE   4  (bases 1 to 5336)
  AUTHORS   Belot MP, Naderi K, Mille C, Boelle PY, Benachi A, Bougneres P and
            Fradin D.
  TITLE     Role of DNA methylation at the placental RTL1 gene locus in type 1
            diabetes
  JOURNAL   Pediatr Diabetes 18 (3), 178-187 (2017)
   PUBMED   27174469
  REMARK    GeneRIF: Data suggest that DNA is differentially methylated
            (hypomethylated) at a gene locus associated with regulation of
            expression of RTL1 and miR136 in type 1 diabetes; these studies
            were conducted using tissue bank placentas and whole blood cell DNA
            from children with type 1 diabetes. (RTL1 = retrotransposon-like
            protein 1; miR136 = microRNA 136)
REFERENCE   5  (bases 1 to 5336)
  AUTHORS   Bundo M, Toyoshima M, Okada Y, Akamatsu W, Ueda J, Nemoto-Miyauchi
            T, Sunaga F, Toritsuka M, Ikawa D, Kakita A, Kato M, Kasai K,
            Kishimoto T, Nawa H, Okano H, Yoshikawa T, Kato T and Iwamoto K.
  TITLE     Increased l1 retrotransposition in the neuronal genome in
            schizophrenia
  JOURNAL   Neuron 81 (2), 306-313 (2014)
   PUBMED   24389010
  REMARK    GeneRIF: The results of this study suggest that hyperactive
            retrotransposition of L1 in neurons triggered by environmental
            and/or genetic risk factors may contribute to the susceptibility
            and pathophysiology of schizophrenia.
REFERENCE   6  (bases 1 to 5336)
  AUTHORS   Kagami M, Sekita Y, Nishimura G, Irie M, Kato F, Okada M, Yamamori
            S, Kishimoto H, Nakayama M, Tanaka Y, Matsuoka K, Takahashi T,
            Noguchi M, Tanaka Y, Masumoto K, Utsunomiya T, Kouzan H, Komatsu Y,
            Ohashi H, Kurosawa K, Kosaki K, Ferguson-Smith AC, Ishino F and
            Ogata T.
  TITLE     Deletions and epimutations affecting the human 14q32.2 imprinted
            region in individuals with paternal and maternal upd(14)-like
            phenotypes
  JOURNAL   Nat Genet 40 (2), 237-242 (2008)
   PUBMED   18176563
  REMARK    GeneRIF: RTL1, a paternally expressed gene in a cluster of
            imprinted genes on chromosome 14q32.2, is associated with
            upd(14)pat-like and upd(14)mat-like phenotypes.
REFERENCE   7  (bases 1 to 5336)
  AUTHORS   Youngson NA, Kocialkowski S, Peel N and Ferguson-Smith AC.
  TITLE     A small family of sushi-class retrotransposon-derived genes in
            mammals and their relation to genomic imprinting
  JOURNAL   J Mol Evol 61 (4), 481-490 (2005)
   PUBMED   16155747
REFERENCE   8  (bases 1 to 5336)
  AUTHORS   Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A,
            Cockett N, Georges M and Charlier C.
  TITLE     RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11
            locus
  JOURNAL   Curr Biol 15 (8), 743-749 (2005)
   PUBMED   15854907
  REMARK    Erratum:[Curr Biol. 2005 May 10;15(9):884]
REFERENCE   9  (bases 1 to 5336)
  AUTHORS   Brandt J, Veith AM and Volff JN.
  TITLE     A family of neofunctionalized Ty3/gypsy retrotransposon genes in
            mammalian genomes
  JOURNAL   Cytogenet Genome Res 110 (1-4), 307-317 (2005)
   PUBMED   16093683
REFERENCE   10 (bases 1 to 5336)
  AUTHORS   Seitz H, Youngson N, Lin SP, Dalbert S, Paulsen M, Bachellerie JP,
            Ferguson-Smith AC and Cavaille J.
  TITLE     Imprinted microRNA genes transcribed antisense to a reciprocally
            imprinted retrotransposon-like gene
  JOURNAL   Nat Genet 34 (3), 261-262 (2003)
   PUBMED   12796779
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL117190.6.
            
            On or before Nov 8, 2023 this sequence version replaced
            XM_047431358.1, XM_054376024.1.
            
            Summary: This gene is a retrotransposon-derived, paternally
            expressed imprinted gene that is highly expressed at the late fetal
            stage in both the fetus and placenta. It has an overlapping
            maternally expressed antisense transcript, which contains several
            microRNAs targeting the transcripts of this gene through an RNA
            interference (RNAi) mechanism. This gene is essential for
            maintenance of the fetal capillaries. [provided by RefSeq, Jul
            2009].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: ERR4352442.307362.1,
                                           ERR4352444.199182.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2142853, SAMEA2149398
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            imprinted gene :: PMID: 18176563
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-118               AL117190.6         143721-143838       c
            119-214             AL117190.6         143407-143502       c
            215-5336            AL117190.6         119869-124990       c
FEATURES             Location/Qualifiers
     source          1..5336
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q32.2-q32.31"
     gene            1..5336
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="retrotransposon Gag like 1"
                     /db_xref="GeneID:388015"
                     /db_xref="HGNC:HGNC:14665"
                     /db_xref="MIM:611896"
     exon            1..118
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /inference="alignment:Splign:2.1.0"
     exon            119..214
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /inference="alignment:Splign:2.1.0"
     exon            215..5336
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    241..243
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="upstream in-frame stop codon"
     CDS             301..4377
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="mammalian retrotransposon derived protein 1;
                     paternally expressed gene 11 protein;
                     retrotransposon-derived protein PEG11; Sushi-Ichi
                     retrotransposon homolog 2; mammalian
                     retrotransposon-derived 1; paternally expressed 11;
                     retrotransposon-like 1"
                     /codon_start=1
                     /product="retrotransposon-like protein 1"
                     /protein_id="NP_001412214.1"
                     /db_xref="GeneID:388015"
                     /db_xref="HGNC:HGNC:14665"
                     /db_xref="MIM:611896"
                     /translation="

MIEPSEDSFETMMEHKNPSSKQMESSEGSSNTTEATSGSGVRGEAGPASGPAQEKKEPPSGPLQEMEELPTDLLQDMEEPSSGPRKEIEDPPNDLLQDLEESCNGSHQARGDPLSGASDRMKEASVNPSGAREEQEAHTDLKESGREETPQEQNQTEHSTAELMAMVRSIISLYFRMQDLKEQQRVAEEILIKGINAGQLPAPKHFSGDRREFHEFIVLCQLTLQSYPRMFYNDRLRVGYVINHLSGLALEWAKALLQENSPLIGDFPAFLEAMSEVFEYRQALRVAEEAMFTIRQGGRSATEYIDEFQSLVPILGWPDEVLQAHLCQGLNEEIRHYLFRVPQPDSLDSLIVLILQIEEKLAERRAMLRLPPEARPRNLTWIDSPAPERWMVSSWLPSEVHPDINRAHLFLLLMVRVNPYHSVAVQALVDSGADGNFMDEKFAQEHYVELYEKPYPQPVQSVDGSLIGNEPVWLYTEPLVCIHQNHQESIEFDIVPSPNFSVVLGIRWLRVHAPEVDWIKGRCTFHSPYCLKNCFRPPPPCIALERHGMSLLPGLPHPYSDLADVFNPKEADDETSDQPSSDGSDDLSESEPSELQQAGDSDHSETFYECPSTAPWEPVGARMQERARLQEEYWDLQDMLTNRQDYIQMIPELFDQLHGAEWFTKLELRGTIVEESVNGHRTEDVWKAAFGLELEEMKSYQPFALSPDPIIPQNVIHFILKDMLGFFVLSYGQEVLIYSMSQEEHLHHVRQVLVRFRHHNVYCSLDKSQFHRQTVEFLGFVVTPKGVKLNKNVMTIITGYPTPGSKLSLRNFIEFVFPYRHFVERFSIIAEPLVRQLLSSYQFYWGVEEQEAFECLKRAFRKAPLLHHPKPQNPFYLETGVTGTALHASLIQIDDQTGKRACCAFYSRNISPIEVEYSQAEMKILPIRAAFMVWCRYLENTEEPIMILLNTEDLASLNNDRLTVLLPGHWVFFFSHFNFDVMELPEQDGGRALPPVRNLRWRRAFQRNTAARQTLLLASRGFPRDPSTESGEEENEEQDELNEQILRQELLAMIPIDQILNSFLAHFSMAQIRAVILHFFRGLLYWKNTLALAAILVLLRVRQCLSLRPAPAMRVARPQPQRSLRLILDSSLIAGSSITTAITQLLTQMPALVGANTIPAQELAELFLGPGRWQRNALHSQAHRGLQFTPGFWLTLCEFFGVRVTPQEGHLPALRQNRYLELHVVGDEDVVLREALQDDLQRYRQCGLHDGLQDTSQDKQDNDVQEAPPSHTAATHPPRPRHLMDPQVLEFLGSRLLHIHSADGQLHLLSREQAARALSQFLTLIYRRALPIPAWESQPREQARLEELPDEDEDANLD"

     misc_feature    301..777
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1987..2148
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    3547..3597
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     transmembrane region"
     misc_feature    3676..3738
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     transmembrane region"
     misc_feature    4048..4149
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    4312..4374
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     regulatory      5317..5322
                     /regulatory_class="polyA_signal_sequence"
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="hexamer: AATAAA"
     polyA_site      5336
                     /gene="RTL1"
                     /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2"
                     /note="major polyA site"
ORIGIN      

acacccccccagcactcggcacagcctcgctgagcagccttcagcagcagggtgtggtggggagcctcggagagtctggggttccatcctggcccagcctcacaccagctgagagacgaccgactgagcttcgaggacaggaagccaccggcatcactaagccaccggcatcacttcatccccagcctcacgcttgggactgggcccggggaaggttctgatctccacggtcccagctactgactggacgccatcacaaccttaccaatcttcagaatacactcctttccatccgacgaaatgatagaaccctctgaagactcatttgagacgatgatggagcataagaatccatcatcaaaacaaatggagtcctccgagggctcatccaacaccaccgaggcgacgtcgggcagtggagtgcggggagaggcagggccagccagcggcccagcccaggaaaagaaggagccccccagtggcccactccaggaaatggaagagctgcccactgatctactccaagacatggaggagccatccagtggcccacgtaaggaaatagaggatccacccaatgacctactccaagacctggaggagtcatgcaacggttcacaccaggcaaggggggatccactcagtggagcatctgataggatgaaagaagcatcagtcaacccatcgggagcccgagaagaacaagaggctcacactgacctgaaggaatcgggaagggaggagactcctcaagagcaaaaccagaccgagcactcaaccgcagaacttatggccatggtgaggtccatcatctcgctgtacttccgaatgcaagacctcaaagagcaacagagagtagcagaagagatcttgatcaaagggatcaatgcaggccaactgcccgccccaaagcacttctctggcgatcgcagagaattccacgagttcatcgtactctgccaactgaccttacagagctacccaagaatgttctataacgaccgtctgagagttggctatgtcatcaatcacctgtccggcttggcattagaatgggccaaagctctactgcaggaaaacagccccctgatcggagacttcccagccttcctggaggccatgtccgaagtgtttgagtaccgccaggcactgcgtgtggcagaagaggccatgttcaccatcaggcagggcggccgctctgccactgagtacatcgatgagttccagagcctggtacccatcttgggctggccagatgaagtcctgcaggcccacttgtgccaggggctcaacgaggagatcaggcactatctattccgggtccctcagccggattccctagacagtctgattgtgctcatcctgcaaatagaagagaagctggcagagagaagagctatgctcaggctgccccccgaggcccgcccccggaacctgacctggatcgactcacctgctccagagaggtggatggtcagcagctggttgcccagcgaagtccatccggacatcaatcgcgcccacctcttcctgctgctcatggtgagagtgaacccctaccacagcgtcgcggtccaggccctggtggattcgggagctgacggcaacttcatggatgagaagttcgcccaagagcactacgtcgagctctacgagaagccgtacccacagccggtccaatccgtggacggctcgctgattggcaacgagcctgtctggctctacacggagcccctggtgtgtatccaccagaaccaccaggagtccatcgaatttgacatcgtaccttcaccgaacttctctgtggtcctaggcatccgctggctccgagtccacgcccccgaagtcgactggatcaaaggccgctgcaccttccactctccctactgcctgaagaactgcttccgcccgcccccgccatgcattgccctagagaggcacggcatgagcctgctacccggactgccacacccatactcagacctggccgacgtgtttaacccgaaggaagcagatgatgagacttccgaccagccaagctcagacggatccgatgatctttctgaatcagagccctctgagcttcagcaggctggagacagtgatcacagcgagaccttttacgagtgtccctccaccgcgccttgggaacctgtgggtgccaggatgcaagaaagagccaggctacaggaggaatactgggacctgcaggacatgctgaccaacagacaggactacatacagatgattccggaactgtttgaccagttacacggagccgagtggttcacaaaactggagctgcgtgggaccattgtggaggaaagcgtgaacgggcaccgcaccgaagatgtgtggaaagcagcgtttggtttggagcttgaagagatgaagagctaccagccgtttgcgctctccccagaccctatcatacctcagaacgtgattcacttcatcctaaaggacatgctagggttctttgtgctttcttatggccaggaagtcctgatctactcaatgagtcaggaggagcacctccaccacgtccgccaagtcctggtccgcttccgccatcacaacgtctactgctccctggacaagagccagttccaccgccaaaccgtggaattcctgggcttcgtcgtcacccccaaaggggtgaaactgaacaagaacgtcatgaccatcataacagggtaccctacccctggctccaagctatctctgcgaaacttcatcgaattcgtcttcccctaccgccacttcgtggagcgcttcagcatcatcgcagagcccctggtgcggcagctgctgagctcctaccagttctactggggagtcgaggagcaagaggccttcgagtgcctgaagagggctttccgcaaggcgcctctcctccaccaccccaagccccagaacccattctacttggaaaccggcgtcaccggcacggccctgcacgcctccctgatccaaatcgacgaccaaaccggcaagagagcctgctgcgctttctactcccgcaacatctcccctatcgaggttgagtactctcaagcggagatgaagattcttccaatacgggctgccttcatggtgtggtgccgctacctggagaacaccgaggagcccatcatgatccttctcaacacagaggatctagcctctctgaataatgacaggctcaccgtacttctccccgggcattgggtcttcttcttctcccacttcaactttgacgtcatggagctgccagaacaagacggcggccgagctctgccacctgtgagaaacctccggtggaggagagccttccagaggaacactgccgccaggcaaaccctgctgctggcctcaaggggattccccagggatccatcgacggaatccggggaagaagagaatgaagaacaggatgagctcaatgaacagatcctacggcaagagctgctggccatgatacccatcgaccagatcctcaacagcttcctcgcccacttcagcatggcccagatcagggccgtcattctgcacttcttccgaggcctcctgtactggaagaacaccctagccctggcagccatcctcgtgctactgcgcgtgaggcaatgcctctcgctgcggccggcacccgccatgcgggtggctcggccccagccccagcgctccctacgactcatcctggattcgtccctcatcgcaggcagcagcatcacgacagccatcacccagctgctcacccagatgcccgctctcgtaggtgcaaacaccatcccagcccaggagctggctgagctgttcctgggccctggccgctggcagcgaaatgctctgcactcccaggcccaccgaggcctgcagttcacccctggcttctggctgacgctgtgtgagttcttcggtgtcagagtcaccccccaggagggccacctccctgccctgcgtcagaaccgctacctggagctgcacgtcgttggtgatgaggatgtcgtcttgcgagaagccctgcaagacgacctgcaacgttaccgtcagtgtggcctgcatgacggcctgcaagacacctcgcaggacaagcaggacaacgacgtgcaggaggccccacccagccacacagcagccacccacccaccccgcccacgccacctgatggatccccaggtcctggaattccttggtagccgcctgctccacatccacagtgcagatggccagctgcacctgctcagccgggagcaggcagccagggccctgagccagttcctgaccctgatctacaggcgggccctgcccatccccgcctgggagagccagcccagggagcaggcaaggctagaagagctgcctgatgaggacgaagatgctaacctcgactgaagacgcctccctgtctccagcaaagagtcccctctatttctcaccccaacacctcccgacgtcccctggcctccccgcgcctcagcctgcttcgcttcccttcctgccactcctgacccaagaggaacccacttgtgaagggcaacaacttcttcaactcatcaaccagcaatgccacctgtgctaacggactacccagtcctcagagacccagcgccagccctgggctacgagttctccgttctccaggtcccaagcccatgcccgggagtgacatccatgagggagaaagcagtggtgagcaggaagtgaccccatgacgcgtggccagatgaagaagcaggcacagcaggcgcagccaagcaagcaggtgacggggccccccacccggcctggtgatggccaccctgggacactgacctcgggtgctccactgacttcttctacctccactgccggtgctcctgctcccctgagctcccgcccccgccccccaacccccatcccccaacctcccgacatctgatgatgtggtgcctccctcacccccatcacaccctgcaagcaaacccacccccacccccaccacatctgcttcagcttttttgaccccgccttcctcttgccctgagctctggacttacctggacaaagccgctctttggggcatccggacgtaccagtgccacttaccagacttgcacagcaaagagggcccctgcatgccttggggcgcctttccctcccaacactgaacactggacagtgcaggggtgcaggggcccctcatacagggatggagtcccagaaggcacacagacacccaggggaccatgccgagtcacagagaggctctggccacaccaccgctttgcaaggggagtagacccttccccaccccccgagctttctcaccccccaatctttttgcactcctcaaataaagcaaactaaaagac

//