ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-03 13:48:02, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001267038 1697 bp mRNA linear PRI 02-AUG-2023
DEFINITION Homo sapiens centromere protein K (CENPK), transcript variant 2,
mRNA.
ACCESSION NM_001267038
VERSION NM_001267038.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1697)
AUTHORS Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
and Wu XL.
TITLE Lentivirus-mediated short hairpin RNA interference of CENPK
inhibits growth of colorectal cancer cells with overexpression of
Cullin 4A
JOURNAL World J Gastroenterol 28 (37), 5420-5443 (2022)
PUBMED 36312839
REMARK GeneRIF: Lentivirus-mediated short hairpin RNA interference of
CENPK inhibits growth of colorectal cancer cells with
overexpression of Cullin 4A.
REFERENCE 2 (bases 1 to 1697)
AUTHORS Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
Zang J and Yao X.
TITLE Structural insights into human CCAN complex assembled onto DNA
JOURNAL Cell Discov 8 (1), 90 (2022)
PUBMED 36085283
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1697)
AUTHORS Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
S, Ma Y, Cai H and Guo T.
TITLE Centromeric protein K (CENPK) promotes gastric cancer proliferation
and migration via interacting with XRCC5
JOURNAL Gastric Cancer 25 (5), 879-895 (2022)
PUBMED 35715658
REMARK GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
proliferation and migration via interacting with XRCC5.
REFERENCE 4 (bases 1 to 1697)
AUTHORS Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
TITLE N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
cervical cancer stemness and chemoresistance
JOURNAL Mil Med Res 9 (1), 19 (2022)
PUBMED 35418160
REMARK GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
promotes cervical cancer stemness and chemoresistance.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1697)
AUTHORS Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
TITLE Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration
JOURNAL Bioengineered 12 (1), 1299-1310 (2021)
PUBMED 33904381
REMARK GeneRIF: Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration.
REFERENCE 6 (bases 1 to 1697)
AUTHORS Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
Desai A and Fukagawa T.
TITLE The CENP-H-I complex is required for the efficient incorporation of
newly synthesized CENP-A into centromeres
JOURNAL Nat Cell Biol 8 (5), 446-457 (2006)
PUBMED 16622420
REFERENCE 7 (bases 1 to 1697)
AUTHORS Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
Cleveland DW.
TITLE The human CENP-A centromeric nucleosome-associated complex
JOURNAL Nat Cell Biol 8 (5), 458-469 (2006)
PUBMED 16622419
REFERENCE 8 (bases 1 to 1697)
AUTHORS Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
TITLE Proteomics analysis of the centromere complex from HeLa interphase
cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
the CEN-complex, while BMI-1 is transiently co-localized with the
centromeric region in interphase
JOURNAL Genes Cells 9 (2), 105-120 (2004)
PUBMED 15009096
REFERENCE 9 (bases 1 to 1697)
AUTHORS Yamashita A, Ito M, Takamatsu N and Shiba T.
TITLE Characterization of Solt, a novel SoxLZ/Sox6 binding protein
expressed in adult mouse testis
JOURNAL FEBS Lett 481 (2), 147-151 (2000)
PUBMED 10996314
REFERENCE 10 (bases 1 to 1697)
AUTHORS Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
K, Yokota J and Morishita K.
TITLE Fusion of the MLL gene with two different genes, AF-6 and
AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
and 11 in infant leukemia
JOURNAL Oncogene 13 (10), 2121-2130 (1996)
PUBMED 8950979
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BG502832.1, BC005400.1 and BC008504.1.
On May 31, 2019 this sequence version replaced NM_001267038.1.
Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
300065)-associated centromeric complex that targets CENPA (MIM
117139) to centromeres and is required for proper kinetochore
function and mitotic progression (Okada et al., 2006 [PubMed
16622420]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (2) differs in the 5' UTR compared
to variant 1. Variants 1 and 2 encode the same isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF315941.1, SRR7346977.403996.1
[ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-56 BG502832.1 2-57
57-1094 BC005400.1 47-1084
1095-1697 BC008504.1 1129-1731
FEATURES Location/Qualifiers
source 1..1697
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q12.3"
gene 1..1697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="centromere protein K"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
exon 1..71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359976795"
variation 2
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313487734"
variation 3
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752349587"
variation 6
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752348893"
variation 7
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752348579"
variation 8
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306504051"
variation 9
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342831242"
variation 11..20
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ggggctggca"
/replace="ggggctggcaggggctggca"
/db_xref="dbSNP:1485277906"
variation 11
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752347563"
variation 12
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231982437"
variation 13
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028359789"
variation 14
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:542352928"
variation 15
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210224911"
variation 19
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265798087"
variation 21
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752345149"
variation 22..25
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gc"
/replace="gcgc"
/db_xref="dbSNP:1257636747"
variation 24
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1226707165"
variation 28
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752344063"
variation 29
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752343711"
variation 30
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:748792667"
variation 31
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1422047918"
variation 32
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1412446096"
variation 33
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473419782"
variation 34
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150581284"
variation 35
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752342051"
variation 36
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1343690787"
variation 37
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140804671"
variation 39
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:553552680"
variation 40
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752340528"
variation 41
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:9791024"
variation 42
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404435189"
variation 45
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1413477558"
variation 46
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011178654"
variation 48
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:892736211"
variation 49
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1293152372"
variation 50
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1752337962"
variation 52
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004353263"
variation 53
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364825946"
variation 55
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752336831"
variation 56
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:41268429"
variation 61
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027093258"
variation 62
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003673595"
variation 63
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:995243929"
variation 64
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:558001621"
variation 69
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1368732818"
variation 71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157875168"
exon 72..139
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 72
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:548499564"
variation 75..77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tag"
/replace="tagttag"
/db_xref="dbSNP:1038778849"
variation 77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757254302"
variation 84
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1751964644"
variation 85
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225478568"
variation 86
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375448951"
variation 90
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751963569"
variation 93
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001509723"
variation 94
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445804221"
variation 99
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171663462"
variation 101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581126138"
variation 103
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374448596"
variation 104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:906122153"
variation 107
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:902390139"
variation 114
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470058908"
variation 115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751960081"
variation 119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1581126047"
variation 127
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150571791"
variation 129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358207757"
variation 130
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173365559"
variation 131
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751958616"
variation 133
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330586449"
variation 134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1337771016"
variation 135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401876701"
variation 137
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1440214129"
exon 140..289
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 144
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443766369"
variation 147
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750737523"
variation 148..151
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ataa"
/replace="ataataa"
/db_xref="dbSNP:1256234642"
variation 148
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:760138230"
variation 152
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:542351057"
misc_feature 155..157
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="upstream in-frame stop codon"
variation 159
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:551599072"
variation 160
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184278791"
variation 161
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164611338"
variation 166
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:748100479"
variation 167
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411927803"
variation 169
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:988842021"
variation 171
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172936444"
variation 173
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:778744562"
variation 176
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403246344"
variation 178
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486299502"
CDS 179..988
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="isoform 1 is encoded by transcript variant 2;
leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
Solt; protein AF-5alpha; interphase centromere complex
protein 37"
/codon_start=1
/product="centromere protein K isoform 1"
/protein_id="NP_001253967.1"
/db_xref="CCDS:CCDS3984.1"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
/translation="
MNQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
misc_feature 179..238
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="propagated from UniProtKB/Swiss-Prot (Q9BS16.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 206..985
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Centromere-associated protein K; Region: CENP-K;
pfam11802"
/db_xref="CDD:432085"
misc_feature 464..469
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Breakpoint for translocation to form
KMT2A/MLL1-CENPK oncogene; propagated from
UniProtKB/Swiss-Prot (Q9BS16.1); other site"
variation 179
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750731325"
variation 181
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:749023060"
variation 185
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139570970"
variation 189
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757460492"
variation 191
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777895549"
variation 195
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2096371242"
variation 197
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:935938524"
variation 200
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150532568"
variation 201
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:758896315"
variation 202
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:75497175"
variation 204
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1216026136"
variation 207
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:371070860"
variation 214
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750726023"
variation 215
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:760004670"
variation 216
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750725249"
variation 224
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397513933"
variation 225
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750724525"
variation 226
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:754218341"
variation 227
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:766178671"
variation 231
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:760347848"
variation 233
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348543974"
variation 236..240
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="actga"
/db_xref="dbSNP:1429400174"
variation 238
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:772652364"
variation 239..247
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gaagaa"
/replace="gaagaagaa"
/db_xref="dbSNP:1347528124"
variation 244
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423115596"
variation 245
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750721303"
variation 248
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150574725"
variation 250
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:201745679"
variation 252
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481438294"
variation 253
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774283954"
variation 254
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141729484"
variation 257
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206680426"
variation 261
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581093357"
variation 267..269
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1437145639"
variation 267
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248409774"
variation 268
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750716760"
variation 270
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:749111718"
variation 274
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750714903"
variation 275
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263513424"
variation 278
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:775244207"
variation 281
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771118232"
variation 282
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:747252575"
variation 287
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868732343"
exon 290..346
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 290
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750271640"
variation 291
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543487501"
variation 292
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043343369"
variation 293
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750268417"
variation 304
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448020199"
variation 305
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762865136"
variation 308
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775330841"
variation 310
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:148016416"
variation 311
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750263924"
variation 312..314
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ttg"
/db_xref="dbSNP:779227890"
variation 312
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454849271"
variation 314
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:144481454"
variation 315
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150519689"
variation 317
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:745593902"
variation 322..333
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aacactcaccga"
/db_xref="dbSNP:1242902542"
variation 324..330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cac"
/replace="cactcac"
/db_xref="dbSNP:757802386"
variation 324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:946304876"
variation 326
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:138527872"
variation 328
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339735347"
variation 330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150519582"
variation 331
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757907403"
variation 332
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141548635"
variation 336
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:201709067"
variation 343
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:755596314"
variation 344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:764377925"
exon 347..419
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 348
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749320661"
variation 349
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:780631678"
variation 353..357
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:1750067937"
variation 353
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750068401"
variation 361
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750067487"
variation 363
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:532263854"
variation 364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328421596"
variation 365
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750066060"
variation 367
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750065565"
variation 368
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278922834"
variation 373
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:746283375"
variation 376..378
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1388017290"
variation 382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:781388497"
variation 383
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751218204"
variation 384
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406983239"
variation 389
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391243960"
variation 390..396
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tca"
/replace="tcagtca"
/db_xref="dbSNP:762598205"
variation 390
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1561685621"
variation 391
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:777349763"
variation 392
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185445391"
variation 393
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425260470"
variation 397
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749780402"
variation 398
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750057694"
variation 400
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1477188242"
variation 401
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1750056781"
variation 403
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750056286"
variation 404..410
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:750256768"
variation 406
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:377608156"
variation 410
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:549718297"
variation 411
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750053838"
variation 412
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:759373577"
variation 413
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753728671"
variation 416
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561685364"
variation 419
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1693238677"
exon 420..466
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 422
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438182467"
variation 425
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:557986609"
variation 427
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:764452510"
variation 429
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:763064949"
variation 430
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1483041739"
variation 431
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212552"
variation 434
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212077"
variation 435..436
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:1403653612"
variation 439
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765236390"
variation 440
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548653305"
variation 442
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771385648"
variation 443
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1286587676"
variation 445
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:138507676"
variation 449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314951065"
variation 450
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:974580309"
variation 453
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773540586"
variation 455..456
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1581021207"
variation 456
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150453321"
variation 460
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581021175"
variation 462..463
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:779363914"
variation 462..463
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1748205064"
variation 463
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228585329"
exon 467..549
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 469
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393117032"
variation 472
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180206825"
variation 478
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150375703"
variation 482
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773628734"
variation 486
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237140365"
variation 495
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232231851"
variation 497
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1193606113"
variation 498
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745284481"
variation 499
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:547550705"
variation 500
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745283514"
variation 502
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1186908669"
variation 506
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748490924"
variation 507
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773901255"
variation 510
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2150375557"
variation 516
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:768317556"
variation 517
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1561634678"
variation 519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748850005"
variation 522
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745280061"
variation 523
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145897680"
variation 524
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:753691260"
variation 529
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376463567"
variation 530
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327050486"
variation 532..535
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aaag"
/db_xref="dbSNP:2150375437"
variation 537
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:140748564"
variation 539
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1286143770"
variation 540
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1745276214"
variation 541
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:745797201"
variation 542
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1302333711"
variation 544
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434037126"
variation 546
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580930674"
variation 547
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:909927578"
exon 550..648
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 552
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745248317"
variation 553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195109001"
variation 554
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745247359"
variation 556
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185309293"
variation 557
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755218264"
variation 558
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138940796"
variation 563
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745244701"
variation 565
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357350104"
variation 566
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265044045"
variation 567
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:892129867"
variation 568
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561633837"
variation 569
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:867891240"
variation 569
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1745242213"
variation 570
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:780195488"
variation 571..602
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ac"
/replace="acagcaacagataatggaatctcttaatgtac"
/db_xref="dbSNP:1745237533"
variation 577
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157077028"
variation 580
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363410017"
variation 589
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756212865"
variation 592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:750466231"
variation 596
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1325715984"
variation 599
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:767952170"
variation 601
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406824741"
variation 602
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580929057"
variation 604
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:150254661"
variation 606
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451415236"
variation 607
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745235605"
variation 608
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580928949"
variation 609..610
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="a"
/db_xref="dbSNP:749771436"
variation 609
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751927567"
variation 610
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:141033147"
variation 615
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:775303734"
variation 616
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1471995857"
variation 622
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425234534"
variation 624
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323742457"
variation 626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745230797"
variation 630
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:540839130"
variation 631
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229775"
variation 634
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229292"
variation 635
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475383930"
variation 639
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1240814809"
variation 640
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1201507225"
variation 641
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452590609"
variation 645
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:199710596"
variation 646
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:776182305"
variation 647
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:770828450"
exon 649..775
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 652
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745162523"
variation 655
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1192069105"
variation 668
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745161624"
variation 671..674
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1238965408"
variation 673
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745161152"
variation 674
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:752112029"
variation 678
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1203948509"
variation 680
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150372287"
variation 683
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745159363"
variation 686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745158892"
variation 689
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:764451391"
variation 690
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:758865586"
variation 691
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:753079695"
variation 695
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765028924"
variation 697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376864120"
variation 706
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745154105"
variation 709..711
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gag"
/db_xref="dbSNP:1231746887"
variation 709
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216777810"
variation 710
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745152720"
variation 714
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378696125"
variation 721
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:538146502"
variation 722
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868259372"
variation 724
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745150168"
variation 727
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745149712"
variation 728
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:765914401"
variation 729
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185768219"
variation 732
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:569355500"
variation 733
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377239133"
variation 734
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773227049"
variation 736
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745146291"
variation 737
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745145818"
variation 739
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172188810"
variation 743
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:866918568"
variation 744
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771962047"
variation 746
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774114264"
variation 748
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176885832"
variation 749
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468783521"
variation 754
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:770061194"
variation 756
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:151068525"
variation 759
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:781204320"
variation 760
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:759021447"
variation 764..768
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1284629517"
variation 766
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745140405"
variation 770..774
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1745137975"
variation 770
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757372616"
variation 775
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409007703"
exon 776..829
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 776
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213991862"
variation 777..787
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaaacattcaa"
/db_xref="dbSNP:1743744485"
variation 780
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:774200181"
variation 782
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1270744844"
variation 783
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561615890"
variation 785
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219885542"
variation 789
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308635150"
variation 795
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:759382373"
variation 806
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:776934831"
variation 807
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580880398"
variation 811
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:376455824"
variation 814
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743741013"
variation 816
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:747162578"
variation 821
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743739935"
variation 823
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440453004"
variation 829
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:777984796"
exon 830..1697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 831
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193515151"
variation 832
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457022289"
variation 835
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407171241"
variation 836..842
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ata"
/replace="ataaata"
/db_xref="dbSNP:1410263007"
variation 836
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484537441"
variation 837
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:779591294"
variation 839..842
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aata"
/db_xref="dbSNP:774484343"
variation 840
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210752666"
variation 842
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346222240"
variation 843..846
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gatt"
/db_xref="dbSNP:1240110785"
variation 848..850
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1161999795"
variation 848
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1322275300"
variation 852
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335325956"
variation 854
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:769017086"
variation 859
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749715663"
variation 860
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755866468"
variation 861..872
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atg"
/replace="atgatccatatg"
/db_xref="dbSNP:1329394537"
variation 861..862
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1373474133"
variation 861
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:542463893"
variation 862
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145412104"
variation 863..864
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tttttt"
/db_xref="dbSNP:771313026"
variation 866
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:960235172"
variation 867
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454009624"
variation 868
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362811635"
variation 871
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580864222"
variation 872
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743131833"
variation 875..878
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1743131212"
variation 880
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:756782808"
variation 882
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:368786771"
variation 884
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1257572242"
variation 892
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:919152018"
variation 894
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489193688"
variation 895
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034387973"
variation 896..897
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:749720138"
variation 897
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1484974307"
variation 898
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:112503088"
variation 900
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001989973"
variation 901
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:899250076"
variation 904
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762786158"
variation 914
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1016654387"
variation 916
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141551708"
variation 918
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206028496"
variation 920
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:752602369"
variation 921
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:147863579"
variation 922
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004913643"
variation 923
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1207772442"
variation 924
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:759344010"
variation 925
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161689071"
variation 926
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743117164"
variation 929
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1386097326"
variation 934
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:528929654"
variation 935..936
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1580863575"
variation 938
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743115124"
variation 940
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1001577205"
variation 942
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1334649862"
variation 948
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:773588233"
variation 950
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:772376049"
variation 951
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414102882"
variation 953
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1350727271"
variation 957
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:762026997"
variation 959
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774554899"
variation 960
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749758005"
variation 962
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:746284263"
variation 964
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:775999649"
variation 966
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:375568861"
variation 968
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:746181867"
variation 972
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1163495587"
variation 974
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228791496"
variation 975
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:933805256"
variation 976
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1279834410"
variation 979
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1487486189"
variation 981
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1244285837"
variation 985
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:36068055"
variation 991
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756880796"
variation 996..999
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743101471"
variation 1001
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260071196"
variation 1002
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:746580111"
variation 1003
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1469027129"
variation 1004
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:777142009"
variation 1006
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:757857332"
variation 1007
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="c"
/db_xref="dbSNP:1472961778"
variation 1008
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:748983371"
variation 1010
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:942422849"
variation 1011
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:752587413"
variation 1015..1019
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1410026237"
variation 1015
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765169647"
variation 1016
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743095898"
variation 1020
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1554102945"
variation 1021
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743094716"
variation 1022
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754847602"
variation 1023
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:753650693"
variation 1026
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:149505574"
variation 1027
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172922491"
variation 1028
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394689518"
variation 1036
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:762116904"
variation 1037..1040
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tatt"
/db_xref="dbSNP:1743090541"
variation 1037
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1459452062"
variation 1038
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:774559990"
variation 1039
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743091117"
variation 1051
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1649200052"
variation 1052
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743090066"
variation 1054
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329637299"
variation 1056
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:904709766"
variation 1060
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743088868"
variation 1063
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1039179836"
variation 1064
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150328447"
variation 1065
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1312201262"
variation 1068..1070
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aca"
/db_xref="dbSNP:1561607792"
variation 1069..1071
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="cat"
/db_xref="dbSNP:1743086947"
variation 1074
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743086428"
variation 1077
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743085588"
variation 1081
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743084567"
variation 1082
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370569166"
variation 1085
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743083080"
variation 1087
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743082614"
variation 1088
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:978818163"
variation 1089
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577792004"
variation 1090
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349464377"
variation 1091
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:945753719"
variation 1092
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:913482577"
variation 1095..1101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gccatct"
/db_xref="dbSNP:3050538"
variation 1095..1101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gccatct"
/replace="gccatctgccatct"
/db_xref="dbSNP:2150328214"
variation 1095
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1580862389"
variation 1099..1102
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tctt"
/db_xref="dbSNP:764130293"
variation 1100..1106
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ctt"
/replace="cttactt"
/db_xref="dbSNP:750310884"
variation 1100
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:993073629"
variation 1101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:199686668"
variation 1103
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:960287476"
variation 1104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:557852862"
variation 1109
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150328136"
variation 1114
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1217910725"
variation 1115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:11952932"
variation 1119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743074804"
variation 1120
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207342510"
variation 1122
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051477604"
variation 1127
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:980313749"
variation 1129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379083883"
variation 1131
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743072067"
variation 1132
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771152778"
variation 1134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1476923760"
variation 1136
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963780201"
variation 1150
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172842501"
variation 1152
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743069976"
variation 1158
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743069574"
variation 1160
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743069146"
variation 1161
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743068751"
variation 1169
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016373653"
variation 1183
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743067853"
variation 1187
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743067391"
variation 1188
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743066970"
variation 1192
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743066553"
variation 1193
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743066123"
variation 1195
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377015673"
variation 1196
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743065238"
variation 1197
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1431598611"
variation 1198
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1476832769"
variation 1209
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063753"
variation 1210
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063346"
variation 1213
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062908"
variation 1215
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062518"
variation 1229
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005290916"
variation 1232
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743061710"
variation 1235
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743061305"
variation 1239
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395176719"
variation 1240..1241
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743060475"
variation 1242
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:950730610"
variation 1243
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:918903214"
variation 1247..1251
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cttac"
/replace="cttacttac"
/db_xref="dbSNP:1743058362"
variation 1249
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743059183"
variation 1250
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1580861850"
variation 1251
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743057940"
variation 1252
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1030344060"
variation 1255
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:998061561"
variation 1258
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743056633"
variation 1260
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743056190"
variation 1263..1267
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1379062344"
variation 1266
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743055799"
variation 1273
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232536793"
variation 1274
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743054584"
variation 1276
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:901106029"
variation 1283..1285
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:2150327537"
variation 1290
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303180714"
variation 1296
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743053398"
variation 1300
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963227783"
variation 1318
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039911851"
variation 1319
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:926467233"
variation 1320
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743050692"
variation 1322..1323
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743050266"
variation 1324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1231285212"
variation 1326
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743049462"
variation 1328
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138007557"
variation 1330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743048540"
variation 1331
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338827386"
variation 1335
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1210597400"
variation 1335
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743047305"
variation 1337
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743046847"
variation 1338
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327342"
variation 1340..1343
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743045993"
variation 1340
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1269715863"
variation 1344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260858610"
variation 1350
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327288"
variation 1354
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1195775126"
variation 1355
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:970156172"
variation 1361
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150327248"
variation 1362
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743044194"
variation 1372
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:555421066"
variation 1379
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743043231"
variation 1380
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743042786"
variation 1382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743042345"
variation 1384
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743041595"
variation 1387
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1248470707"
variation 1390
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:535728857"
variation 1392
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743040225"
variation 1393
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743039797"
variation 1396
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743039346"
variation 1402
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038929"
variation 1408
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038506"
variation 1413
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743038099"
variation 1414..1417
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1743037214"
variation 1415
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743037649"
variation 1418..1419
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743036202"
variation 1418
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:181291384"
variation 1421
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:956248428"
variation 1422
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1457981299"
variation 1423
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:191377833"
variation 1424..1428
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1743032082"
variation 1424
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743033537"
variation 1426
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:539417576"
variation 1430
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1164554935"
variation 1432
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743030703"
variation 1434
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042853202"
variation 1437
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1199984915"
variation 1448
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1388092390"
variation 1454
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743028067"
variation 1458
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1343109599"
variation 1459
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1031647042"
variation 1460
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437815344"
variation 1461
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743024787"
variation 1464
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743024219"
variation 1466
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743023557"
variation 1467
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294075340"
variation 1473
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:945709709"
variation 1475
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150326827"
variation 1476
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021901"
variation 1477
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1326412701"
variation 1479
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021208"
variation 1482
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000450375"
variation 1483..1484
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tt"
/db_xref="dbSNP:1743019563"
variation 1485
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:374187039"
variation 1492
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1743018191"
variation 1498
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743017506"
variation 1499
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354485971"
variation 1500
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056728221"
variation 1506
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743016253"
variation 1507
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1213331032"
variation 1512
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268486647"
variation 1523
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743014908"
variation 1525..1526
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1743014111"
variation 1525
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743014523"
variation 1526
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1039250611"
variation 1527
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743013272"
variation 1531
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743012845"
variation 1539
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186533991"
variation 1543
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011987"
variation 1546
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011557"
variation 1550..1553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743010647"
variation 1550
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1340299966"
variation 1553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743010222"
variation 1558
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424395658"
variation 1559
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:532743192"
variation 1560..1567
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tatta"
/replace="tattatta"
/db_xref="dbSNP:1743008574"
variation 1561
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366225240"
variation 1566..1570
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1159449444"
variation 1567
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1460556343"
variation 1570..1576
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="atatcat"
/db_xref="dbSNP:1459141015"
variation 1571
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1389766148"
variation 1572
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743006871"
variation 1575
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743006467"
variation 1579
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:927562539"
variation 1580
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150326376"
variation 1581
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743005152"
variation 1582
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743004554"
variation 1585
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1287552641"
variation 1587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361828535"
variation 1589
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:980658237"
variation 1593
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314885435"
variation 1594
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743001315"
variation 1598
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743000469"
variation 1603
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1353680059"
variation 1606
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1327594781"
variation 1607
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051966282"
variation 1612
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1289235686"
variation 1613..1619
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atta"
/replace="attatta"
/db_xref="dbSNP:1331567359"
variation 1616
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742997647"
variation 1618
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742996975"
variation 1620
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742995591"
variation 1623
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1742994796"
variation 1624
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:929048520"
variation 1626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:369693784"
variation 1644
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1259977140"
variation 1651
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1483507690"
variation 1652
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202138533"
variation 1653
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742990821"
variation 1657..1660
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:897488737"
variation 1665
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176718170"
variation 1671..1679
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaat"
/replace="aaataaaat"
/db_xref="dbSNP:1421192369"
regulatory 1672..1677
/regulatory_class="polyA_signal_sequence"
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="hexamer: AATAAA"
variation 1673
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1464857841"
variation 1678..1683
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="att"
/replace="attatt"
/db_xref="dbSNP:1580860318"
variation 1686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742987371"
variation 1687
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742986932"
variation 1694
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:879097828"
variation 1695
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1182336846"
polyA_site 1697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="major polyA site"
ORIGIN
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccagtttttcttataaggctaaaaattcacaaagcatatatcaatgaatcaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]