GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-22 13:11:18, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_005857750            1209 bp    RNA     linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus uncharacterized LOC121109953
            (LOC121109953), ncRNA.
ACCESSION   XR_005857750
VERSION     XR_005857750.2
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052533.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 1, 2022 this sequence version replaced XR_005857750.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1209
                     /organism="Gallus gallus"
                     /mol_type="transcribed RNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..1209
                     /gene="LOC121109953"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 long SRA read, and 100% coverage
                     of the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="CGNC:89819"
                     /db_xref="GeneID:121109953"
     ncRNA           1..1209
                     /ncRNA_class="lncRNA"
                     /gene="LOC121109953"
                     /product="uncharacterized LOC121109953"
                     /db_xref="GeneID:121109953"
                     /db_xref="CGNC:89819"
ORIGIN      
aggtcataatgacctccattcctgttggacatcctgctatttgtgggttagacttggacttcggccacatttaatagcccctcctggatcaccccccttagacaaggtcagcctgagcctgctttgggcataccctggggaagatatggattcctgcaatgttttggactgtgagtacatcaggatgaagagtctgtgttggtgtttgtggtgtacaggcttctgattcaggtattcctgctgtgttacacaatagctgtctcatgcagcaagcactagagaactacagcagatgaagtgcttggtgacatgaaggaacaagcagatctatgaacagtggaaacaatacaacaagttttccgacgtatttgtgccacctagtagtctcctttaacatctaacagcatgagtggggaatcaaatcttctgccactgctgggatactcacagcatcgctccactgggcataatatggtgtctaataaagaattaacagaacagcttgcttctcagttgggtgcacacataagctgcatctacactactaaattaaacaatactagggaacgtttccaagcactggaacttgatcaactattcagttaaattgtgagaatactagctggcatggttctgaccagagaaaactagcactttcttaaacagttcccaggaactacttaaaagttagaaaatgccaaggcccatcaaaataggcatttggacatggccacccttcttggaagggtaagagagtttaatagtacggaatctttgtttggtgccagttggcttcaggagcacagaacagtactaggcatgtttagctcgctactatagatgtagccatagcctatttttgctccacccagtttctgattttcataacagttgtgggaataaaatgtctttgaaatgacccagggttttttttgtttgttttgtttttctttaatgttggattgaactgactgacagaacgatgcacacccacatccgtaagcatctacctaccagcatacacacacacccatatgtacacatagaacatgaccatgcatatacacctgtacatacacatacttaaatacatatatgcaattaaagaactggagcatgtaaatatcatttcttcagtataatgtcttgcaaaaatttacaaaatcttgccacagctccctcgagatatacgtttgaggagaatttccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]