ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-03-07 09:28:37, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_040686065 2469 bp mRNA linear VRT 01-MAR-2022
DEFINITION PREDICTED: Gallus gallus DEAD-box helicase 31 (DDX31), transcript
variant X1, mRNA.
ACCESSION XM_040686065
VERSION XM_040686065.2
DBLINK BioProject: PRJNA698614
KEYWORDS RefSeq.
SOURCE Gallus gallus (chicken)
ORGANISM Gallus gallus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
Phasianidae; Phasianinae; Gallus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_052589.1) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
On Mar 1, 2022 this sequence version replaced XM_040686065.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Gallus gallus Annotation Release 106
Annotation Version :: 106
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 9.0
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..2469
/organism="Gallus gallus"
/mol_type="mRNA"
/isolate="bGalGal1"
/db_xref="taxon:9031"
/chromosome="17"
/sex="female"
/tissue_type="blood"
/geo_loc_name="USA: Fayetteville"
/lat_lon="36.0822 N 94.1719 W"
/collection_date="20-May-2019"
/collected_by="Nick Anthony"
gene 1..2469
/gene="DDX31"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 15 mRNAs, 7 ESTs, 119 long SRA
reads, 12 Proteins, and 100% coverage of the annotated
genomic feature by RNAseq alignments, including 93 samples
with support for all annotated introns"
/db_xref="CGNC:2579"
/db_xref="GeneID:427759"
misc_feature 1
/gene="DDX31"
/experiment="COORDINATES: cap analysis [ECO:0007248]"
/note="transcription start site"
CDS 43..2151
/gene="DDX31"
/codon_start=1
/product="probable ATP-dependent RNA helicase DDX31
isoform X4"
/protein_id="XP_040541999.1"
/db_xref="GeneID:427759"
/db_xref="CGNC:2579"
/translation="
MEEDGPLLLNLGSAPRRQPNALKRKLQSSPHGNPPLKRKPKPSVNNFKKRVAETGTREKGRSSKRSLPKKQLNANQNESQKSKLFIKTSSLFRNNPDIPEIHRKAVQQVQENVFTTDSFSQLDLHPHLIATITTVLKICSMTSVQKQTIPVLLQGKDALVRSQTGSGKTLAYGIPLVQSLQGMQSKIQRSDGPYALVLVPTRELALQTFDTIQKLLKPFTWIVPGVLMGGEKRKSEKARLRKGINILISTPGRLVDHIKSTECIHFRRTQWLIIDEADRILDLGFEKDVTVILNALNAERETRQNVLLSATLTEGVTRLADISLNDPIRISIADEIRESLKPALQTEKEANSSSNRMDQENFAVPEKLKQYFMMVPSKLRLVTLAAFVLEKCKYEKQHKMIIFFSSCEQVEFHYELLVNVLSGELESEQPKRSSVSSVQLQFLRLHGNMEQEERTEVFQEFLKSKTGILLCTDVAARGLDLPQVTWIVQYNAPASPAEYIHRIGRTARIGCHGNSLLVLAPSEAEYVSLLASHKINVSEIKMEKVLSSLMKDDRFRLRRPGSKKSYGVDPQEVRERATVLQTQFENYVHSSEGTIRWAKKALQSFLCAYTAYPRSLKHIFHIKSIHLGHVAKSFGLRDAPQNLTTLPTANSKKKTKPRAKRSDLLKKTHGKHRLAEILRSEYSSGMDTGVSKVKKKKKKKTD"
misc_feature 394..1770
/gene="DDX31"
/note="Superfamily II DNA and RNA helicase [Replication,
recombination and repair]; Region: SrmB; COG0513"
/db_xref="CDD:440279"
misc_feature 424..1035
/gene="DDX31"
/note="DEAD-box helicase domain of DEAD box protein 31;
Region: DEADc_DDX31; cd17949"
/db_xref="CDD:350707"
misc_feature order(451..456,460..468,475..477,529..552)
/gene="DDX31"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:350707"
misc_feature 1783..1965
/gene="DDX31"
/note="Domain of unknown function (DUF4217); Region:
DUF4217; pfam13959"
/db_xref="CDD:464056"
polyA_site 2469
/gene="DDX31"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
ggggctgtcccggcgctgcctgagcgcggccgcctcggcgcgatggaggaggacgggccgctgctcctcaacctcggctcggctcccaggcggcagcctaatgctctgaaaagaaagctccagtcgtcaccacatggaaacccacctctgaaacgtaaacctaagccatcagtaaacaacttcaagaaacgtgttgcagagactggcaccagggaaaagggaagatcatcaaaaaggtctcttcctaagaagcaactgaatgccaaccaaaatgaaagccagaaaagcaaacttttcattaagacatccagcctgtttagaaacaaccctgatatcccagaaattcacagaaaagcagtgcagcaggtgcaggaaaatgttttcactacagactctttcagccagttggacctccatccacacctgatagccacaataactacagttctgaagatatgtagtatgaccagtgttcagaagcaaacaattcctgtgctcctgcaaggcaaagatgctctggtgagatctcagactggttcaggtaaaactcttgcctatggaattccacttgtacagtccttgcaaggaatgcaatccaaaatacagcgaagtgacgggccttatgcactggtgttagtcccaacaagagagcttgcactccagacttttgatacaatacagaagctactcaagccatttacctggattgttcctggagtgcttatggggggagaaaagagaaaatcagaaaaagccagattacggaaggggataaatatccttatttcaactcctggtcgcctggttgatcacatcaagtccacggaatgtattcatttccgtcgcactcagtggctgatcattgatgaagcagacaggatcctagacctgggctttgagaaggatgtaactgtgatacttaatgctttaaatgctgagagggagacgcgtcagaatgttctgctctcagccacactcactgaaggagtaacacggctggctgatatcagtttgaacgatcccatcagaatttccatagcagatgaaatccgggagagtctcaaaccagcattacaaacagaaaaagaagccaatagttcctcaaaccgtatggaccaggaaaactttgctgttccagagaagcttaagcagtatttcatgatggtccccagcaaattgaggcttgtcacattagcagcttttgtcctagagaaatgcaagtatgaaaagcaacataagatgatcatctttttctccagttgtgaacaagtggaattccactacgagctccttgttaatgtcctttcaggagagctagagtctgaacaacctaaacgttcatctgtctcctctgtgcaattacagtttctacgactgcatgggaacatggaacaggaagaaagaacagaggtcttccaggagttcctaaaatccaaaaccggcatcttactttgcactgatgtcgcagcacgtggactagacctgcctcaagtcacgtggattgtgcagtataacgctccagcttcacctgcggaatacatccaccggatcgggaggacggctcggattggctgtcacgggaacagcctgcttgtcctggcgccttcggaggcagaatatgtcagcttgctggcttctcacaagattaatgtctccgagataaagatggagaaggtactatccagcctgatgaaagacgatcgcttcaggctgcgcagaccaggaagcaagaaatcctatggcgtggaccctcaggaagtccgggagcgggccaccgtcctgcagacacaatttgagaattatgttcactccagtgaggggaccatccggtgggcaaaaaaagcactgcagtcttttctttgtgcctacaccgcctatcccagaagcctcaagcacatcttccacatcaaatctatccacctgggtcatgtggccaagagctttggcctgagagatgctccccagaacctgactactcttccaactgctaactcaaagaagaaaaccaaaccaagagcaaaaaggtctgaccttctcaagaagacccatggcaaacatcgcctggctgagatcttgcgatctgaatattccagtgggatggacactggtgtatccaaggtcaagaagaagaagaagaaaaaaacagactaaaactggcaaccagcagatcccagtatgagccaggacctcccagtcatttgctgcacaacctgctggagtacgtcagccagaggtcagggtgacctgccagactgactgacgagtggctcagtttgtcaggcaaaaatggggagggctcttggagatgctgacctcctccctcttatcccatagttccaaatggaattgaatccagacgtgtcctgttgcactgctgcaattatatgtggcttcctgaagatgcagcttgtttctaaggtgatattttgtgagaaaaataaaagagtttaattacggttttctgagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]