GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 14:24:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_025155047            2021 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus eukaryotic translation initiation factor 2
            alpha kinase 1 (EIF2AK1), transcript variant X1, mRNA.
ACCESSION   XM_025155047
VERSION     XM_025155047.3
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052545.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 1, 2022 this sequence version replaced XM_025155047.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2021
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="14"
                     /sex="female"
                     /tissue_type="blood"
                     /country="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..2021
                     /gene="EIF2AK1"
                     /note="eukaryotic translation initiation factor 2 alpha
                     kinase 1; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 10 ESTs, 168 long SRA
                     reads, and 100% coverage of the annotated genomic feature
                     by RNAseq alignments, including 79 samples with support
                     for all annotated introns"
                     /db_xref="CGNC:2470"
                     /db_xref="GeneID:395360"
     misc_feature    1
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             57..1946
                     /gene="EIF2AK1"
                     /codon_start=1
                     /product="eukaryotic translation initiation factor 2-alpha
                     kinase 1 isoform X1"
                     /protein_id="XP_025010815.2"
                     /db_xref="GeneID:395360"
                     /db_xref="CGNC:2470"
                     /translation="
MWRGREVPPRAAAHRPPPAIQFPEESPEPRFDESDVPAELRVANGSQKFVNFTSTIQNQLLLVSLLEHLCHMYTHNLVHSRCLFRILRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
     misc_feature    510..1820
                     /gene="EIF2AK1"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     eukaryotic translation Initiation Factor 2-Alpha Kinase 2
                     or Heme-Regulated Inhibitor kinase; Region:
                     STKc_EIF2AK1_HRI; cd14049"
                     /db_xref="CDD:270951"
     misc_feature    order(510..518,525..530,666..671,678..683,687..692,
                     714..740,744..746,1206..1208,1368..1370,1377..1385)
                     /gene="EIF2AK1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    528..>1097
                     /gene="EIF2AK1"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:451246"
     misc_feature    order(549..554,567..569,573..575,612..614,618..620,
                     1218..1229,1236..1238,1410..1415,1419..1421,1455..1457,
                     1554..1562,1653..1655,1659..1682)
                     /gene="EIF2AK1"
                     /note="active site"
                     /db_xref="CDD:270951"
     misc_feature    order(549..554,567..569,573..575,612..614,618..620,
                     711..713,1218..1229,1236..1238,1398..1400,1404..1406,
                     1410..1415,1419..1421,1455..1457)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    order(549..560,567..569,573..575,612..614,618..620,
                     711..713,834..836,837..839,945..947,954..956,960..962,
                     1062..1067)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(1452..1481,1527..1562)
                     /gene="EIF2AK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270951"
     misc_feature    order(1554..1562,1653..1655,1659..1682)
                     /gene="EIF2AK1"
                     /note="eIF2alpha (substrate) binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270951"
     polyA_site      2021
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaacctcgtgcactcgaggtgcttgttccgaatacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]