LOCUS       NM_205267               1268 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus nucleophosmin (NPM1), mRNA.
ACCESSION   NM_205267
VERSION     NM_205267.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1268)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1268)
  AUTHORS   Duan Z, Chen J, Xu H, Zhu J, Li Q, He L, Liu H, Hu S and Liu X.
  TITLE     The nucleolar phosphoprotein B23 targets Newcastle disease virus
            matrix protein to the nucleoli and facilitates viral replication
  JOURNAL   Virology 452-453, 212-222 (2014)
   PUBMED   24606698
  REMARK    GeneRIF: Phosphoprotein B23 targets Newcastle disease virus matrix
            protein to the nucleoli and facilitates viral replication.
REFERENCE   3  (bases 1 to 1268)
  AUTHORS   Duan Z, Chen J, He L, Xu H, Li Q, Hu S and Liu X.
  TITLE     [Matrix protein of Newcastle disease virus interacts with avian
            nucleophosmin B23. 1 in HEK-293T cells]
  JOURNAL   Wei Sheng Wu Xue Bao 53 (7), 730-736 (2013)
   PUBMED   24195380
  REMARK    GeneRIF: Matrix protein of Newcastle disease virus interacts with
            chicken nucleophosmin B23.1.
REFERENCE   4  (bases 1 to 1268)
  AUTHORS   Mukudai Y, Kubota S, Kawaki H, Kondo S, Eguchi T, Sumiyoshi K,
            Ohgawara T, Shimo T and Takigawa M.
  TITLE     Posttranscriptional regulation of chicken ccn2 gene expression by
            nucleophosmin/B23 during chondrocyte differentiation
  JOURNAL   Mol Cell Biol 28 (19), 6134-6147 (2008)
   PUBMED   18678650
  REMARK    GeneRIF: The present study reveals a novel aspect of NPM/B23 as a
            key player in the posttranscriptional regulation of ccn2 mRNA
            during the differentiation of chondrocytes.
REFERENCE   5  (bases 1 to 1268)
  AUTHORS   Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning
            MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER,
            Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE,
            Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J and
            Wilson SA.
  TITLE     Transcriptome analysis for the chicken based on 19,626 finished
            cDNA sequences and 485,337 expressed sequence tags
  JOURNAL   Genome Res 15 (1), 174-183 (2005)
   PUBMED   15590942
REFERENCE   6  (bases 1 to 1268)
  AUTHORS   Maridor G, Krek W and Nigg EA.
  TITLE     Structure and developmental expression of chicken nucleolin and
            NO38: coordinate expression of two abundant non-ribosomal nucleolar
            proteins
  JOURNAL   Biochim Biophys Acta 1049 (2), 126-133 (1990)
   PUBMED   2114180
REFERENCE   7  (bases 1 to 1268)
  AUTHORS   Maridor G and Nigg EA.
  TITLE     cDNA sequences of chicken nucleolin/C23 and NO38/B23, two major
            nucleolar proteins
  JOURNAL   Nucleic Acids Res 18 (5), 1286 (1990)
   PUBMED   2320420
REFERENCE   8  (bases 1 to 1268)
  AUTHORS   Borer RA, Lehner CF, Eppenberger HM and Nigg EA.
  TITLE     Major nucleolar proteins shuttle between nucleus and cytoplasm
  JOURNAL   Cell 56 (3), 379-390 (1989)
   PUBMED   2914325
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000256.1.
            
            On Sep 23, 2021 this sequence version replaced NM_205267.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01012407.1, HAEK01009853.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-127               JAENSK010000256.1  1518579-1518705     c
            128-207             JAENSK010000256.1  1517973-1518052     c
            208-327             JAENSK010000256.1  1515094-1515213     c
            328-421             JAENSK010000256.1  1514373-1514466     c
            422-525             JAENSK010000256.1  1513755-1513858     c
            526-587             JAENSK010000256.1  1513215-1513276     c
            588-642             JAENSK010000256.1  1512778-1512832     c
            643-732             JAENSK010000256.1  1511598-1511687     c
            733-834             JAENSK010000256.1  1510689-1510790     c
            835-909             JAENSK010000256.1  1508837-1508911     c
            910-1268            JAENSK010000256.1  1507498-1507856     c
FEATURES             Location/Qualifiers
     source          1..1268
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="13"
                     /map="13"
     gene            1..1268
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="nucleophosmin"
                     /db_xref="CGNC:49698"
                     /db_xref="GeneID:396203"
     exon            1..127
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     CDS             64..948
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="nucleolar phosphoprotein B23; NPM; numatrin;
                     nucleolar protein NO38; nucleophosmin (nucleolar
                     phosphoprotein B23, numatrin)"
                     /codon_start=1
                     /product="nucleophosmin"
                     /protein_id="NP_990598.2"
                     /db_xref="CGNC:49698"
                     /db_xref="GeneID:396203"
                     /translation="

MEDSAMDMESMGPLRPQTFLFGCELKAEKEYQFKVDDEENEHQLSLRTVTLGAGAKDELHVVEAEALDYEGNPTKVVLASLKMSVQPTVSLGGFEITPPVVLRLKCGSGPVYVSGQHLVALEEEPESEDEEEDTKIGNASTKRPASGGGAKTPQKKPKLSEDDEDDDEDEDDDEDDEDDLDDDEEEIKTPMKKPAREPAGKNMQKAKQNGKDSKPSTPASKTKTPDSKKDKSLTPKTPKVPLSLEEIKAKMQASVDKGCSLPKLEPKFANYVKNCFRTEDQKVIQALWQWRQTL"

     misc_feature    121..420
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Nucleoplasmin/nucleophosmin domain; Region:
                     Nucleoplasmin; pfam03066"
                     /db_xref="CDD:427119"
     misc_feature    232..234
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Interaction between pentamers.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P16039.1); other site"
     misc_feature    307..309
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Interaction between pentamers.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P16039.1); other site"
     misc_feature    424..795
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    520..537
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     misc_feature    631..651
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     misc_feature    796..942
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Nucleophosmin C-terminal domain; Region: NPM1-C;
                     pfam16276"
                     /db_xref="CDD:435252"
     exon            128..207
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            208..327
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            328..421
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            422..525
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            526..587
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            588..642
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            643..732
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            733..834
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            835..909
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            910..1268
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

agtgcgcgtccgtccgcagcgccgcatcccgtacagctcctcccgcgcgagcaggccgagaagatggaggacagcgccatggacatggagagcatgggcccgctgcgcccgcagaccttcctcttcggctgcgagcttaaagcagagaaggaatatcagttcaaagtagatgatgaggaaaacgagcatcagctgtccttgagaacggttacattaggggctggagccaaagacgaattacatgttgtagaagcagaagcactggactacgaaggcaacccaactaaagtagtactggcatctctgaaaatgtctgtgcagcctacagtttcactaggtggatttgagatcacaccaccagttgtcttgaggttaaaatgtggttcggggcctgtttatgtcagtggtcagcatcttgtagcattagaggaagagccagaatcagaggatgaggaggaggatacaaaaatagggaatgcttcaacaaagagaccagcaagtggaggaggagctaaaacaccacagaaaaaaccaaaattatcagaagatgatgaggacgatgatgaagatgaggatgatgatgaggatgatgaagacgacttggatgatgatgaggaggagattaaaacaccaatgaagaaacctgcccgcgagcctgcaggaaaaaatatgcagaaagcaaagcaaaatggaaaagactcaaagccgtccacaccagcatctaaaacaaaaactccagattccaagaaggacaaatctctaactccaaaaacaccgaaagttcctctgtcgttagaggagatcaaagcaaaaatgcaggcctccgtagacaagggttgttcccttcctaagctggagcccaaatttgccaactatgttaagaattgcttcaggacggaggaccaaaaggtcattcaagctctctggcagtggagacagactctgtaagagaacaatttaaacagtttgttaaagtctgcagtcttacttctgtaaccattatttggctgttctttttacaaatgctgaaagagctttccctacagtgtctgataaatgtcatccagattaccttgccaagaatgtgttgtccaaaatgcctgtttagtttttaaagatgggactccaccctcagcttcattttaagtatgtatggaatgttttgataaggcatggtggtgtggtggtggtggtcagacaaatggaagtggtgggaagactaaatgtacgtggaaaaaaaaaataaaatttagtattttaataaagta

//