LOCUS       NM_205068               1839 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus gastrulation brain homeobox 2 (GBX2), mRNA.
ACCESSION   NM_205068
VERSION     NM_205068.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1839)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1839)
  AUTHORS   Roellig D and Bronner ME.
  TITLE     The epigenetic modifier DNMT3A is necessary for proper otic placode
            formation
  JOURNAL   Dev Biol 411 (2), 294-300 (2016)
   PUBMED   26826496
  REMARK    GeneRIF: DNMT3A is important for enabling the activation of Gbx2
            expression, necessary for normal development of the inner ear
REFERENCE   3  (bases 1 to 1839)
  AUTHORS   Steventon B, Mayor R and Streit A.
  TITLE     Mutual repression between Gbx2 and Otx2 in sensory placodes reveals
            a general mechanism for ectodermal patterning
  JOURNAL   Dev Biol 367 (1), 55-65 (2012)
   PUBMED   22564795
  REMARK    GeneRIF: Otx2 and Gbx2 provide a global mechanism for patterning of
            the embryonic ectoderm and ensure the coordinated development of
            the central and peripheral nervous system in the head.
REFERENCE   4  (bases 1 to 1839)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1839)
  AUTHORS   Merchan P, Bardet SM, Puelles L and Ferran JL.
  TITLE     Comparison of Pretectal Genoarchitectonic Pattern between Quail and
            Chicken Embryos
  JOURNAL   Front Neuroanat 5, 23 (2011)
   PUBMED   21503155
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1839)
  AUTHORS   Miyazaki H, Kobayashi T, Nakamura H and Funahashi J.
  TITLE     Role of Gbx2 and Otx2 in the formation of cochlear ganglion and
            endolymphatic duct
  JOURNAL   Dev Growth Differ 48 (7), 429-438 (2006)
   PUBMED   16961590
  REMARK    GeneRIF: Results suggest that the interaction between Gbx2 and Otx2
            in developing inner ear defines Fgf10 expression domain to induce
            the cochlear ganglion and that Gbx2 expression is important for the
            formation of the endolymphatic duct.
REFERENCE   7  (bases 1 to 1839)
  AUTHORS   Sanchez-Calderon H, Martin-Partido G and Hidalgo-Sanchez M.
  TITLE     Otx2, Gbx2, and Fgf8 expression patterns in the chick developing
            inner ear and their possible roles in otic specification and early
            innervation
  JOURNAL   Gene Expr Patterns 4 (6), 659-669 (2004)
   PUBMED   15465488
  REMARK    GeneRIF: Otx2, Gbx2, and Fgf8 are expressed in the chick developing
            inner ear
REFERENCE   8  (bases 1 to 1839)
  AUTHORS   Kowenz-Leutz E, Herr P, Niss K and Leutz A.
  TITLE     The homeobox gene GBX2, a target of the myb oncogene, mediates
            autocrine growth and monocyte differentiation
  JOURNAL   Cell 91 (2), 185-195 (1997)
   PUBMED   9346236
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000235.1.
            
            On Oct 19, 2021 this sequence version replaced NM_205068.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF022151.1, BI393586.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992440, SAMEA103992453
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-768               JAENSK010000235.1  5210503-5211270
            769-1839            JAENSK010000235.1  5211730-5212800
FEATURES             Location/Qualifiers
     source          1..1839
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="7"
                     /map="7"
     gene            1..1839
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="gastrulation brain homeobox 2"
                     /db_xref="CGNC:10048"
                     /db_xref="GeneID:395950"
     exon            1..768
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    141..143
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="upstream in-frame stop codon"
     CDS             273..1295
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="gastrulation brain homeo box 2; gastrulation and
                     brain-specific homeobox protein 2; gastrulation brain
                     homeobox 2 protein; gastrulation brain homeobox 1"
                     /codon_start=1
                     /product="homeobox protein GBX-2"
                     /protein_id="NP_990399.1"
                     /db_xref="CGNC:10048"
                     /db_xref="GeneID:395950"
                     /translation="

MSAAFQPSLMMMQRPLGSSTAFSIDSLIGSPPPPAPGHFVYTGYPMFMPYRPVVLPPPPPALPQAALQPPLPPAPPPPLPALPGAFCPGLAQGMALTSTLMAALPGSFPASPPRPEAARKFAPPGNFDKADGLPPPDGGGGGGDDGKTGGGLLPFPAADAVHASLAGALRGGPKDDPKAEEEAKGREENFSMDSDLDYSSDENGPAPAAPREEDCGTALEENPPSAANAAANAAATGKNRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRVKAGNASSKAGEPSRNPKIVVPIPVHVSRFAIRSQHQQLEQARP"

     misc_feature    588..737
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="propagated from UniProtKB/Swiss-Prot (O42230.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    771..998
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="propagated from UniProtKB/Swiss-Prot (O42230.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(990..1004,1008..1010,1059..1061,1077..1079,
                     1116..1118,1122..1127,1134..1139,1143..1151,1155..1160)
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    996..1157
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(996..998,1005..1007,1125..1127,1134..1139,
                     1146..1148)
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            769..1839
                     /gene="GBX2"
                     /gene_synonym="GBX1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

aaaatgtgaatgggcgcgggggagcgggcgggcagaggcagcgcggtgcggggcggcggggggcggccggccccgatgtgcgggcggcggcggccccgctccgccccggctcggccccacgcgtgggcgctgcgcggcgctgagctgcgggagccggagcccgagcccgagcaagaggaggaggaggaggaggaggaggaggaggaggaagaagaagaagaggaggaggaggaggaagaaggtggtcgccgctgctcctccgccggcccggcatgagcgcggctttccagccctcgctgatgatgatgcagcgcccgctgggaagcagcacggccttcagcatcgattcgctcatcggcagccccccgccgcccgcccccggccacttcgtctacaccggctaccccatgttcatgccgtaccggcccgtcgtgctgccccccccgccgcccgccctgccgcaggccgccctgcagccgccgttgccccccgcgccgcccccgccgctgcccgcgttgcccggagccttctgccccgggctggcgcagggcatggccctcacctccacgctgatggccgcgctgcccggctccttccccgcctccccgccgcgccccgaggccgccaggaagttcgcccccccggggaacttcgacaaggccgacggactgcctcccccggacggcggcggcggcggcggagacgacggcaaaaccgggggggggctgctacccttccccgctgccgacgccgtgcacgcatcgctggccggggccctccgcggcggccccaaagacgatcccaaagcggaggaggaggcgaagggccgcgaggagaacttctccatggacagcgacctcgactacagctccgacgagaacggccccgcgccggcggccccgcgggaggaggactgtggcaccgcgttggaggagaacccccccagcgccgccaacgccgccgccaacgccgcggccacggggaagaaccgacggcggcggacggcgttcaccagcgagcagctgctggagctggagaaggagttccactgcaagaagtacctctcgctgacggagcgctcgcagatcgcgcacgccctgaagctgagcgaggtgcaggtgaagatctggttccagaacaggcgagccaaatggaagcgggtgaaggcgggcaacgccagctccaaggcgggggaaccgtcgcggaaccccaagatcgtcgtgcccatccccgtgcacgtcagccgcttcgccatcaggagtcagcaccagcagctggagcaggcgcggccctgagcgccgctgggggggcaaaaaagttgacaaccggggttttcgccggacccgctctgaaaagcgaaacgagcgacggaaaccaacccaaacagacgaaaacgacccaagcgaacgacccaaacgaacgcctccccgcccccccaaaatgaacctagaagcgacgcgactccaccggcgacccacgagcgatacggcggagccccacgccggcagcgagcggcagaactgaaggcggaacgccgcgcggagcggggccggggaccgggaccgcatcgccccgcagcgccacgggataacggcgctgggggagccgtcggtgcggggccgcccctcgcagagccgcgttgagaggagagggggagagagagagagagaggaggggaggggggggaggaggacggacggacggacggacagacggacaccgaggaaagcacgaattcagcgttgtggtttaatttatttcgatgtagcccgtttccttctaagttatgaaatttaaggagccaactcccgtcttgtgaataaaagccgacaaagaaac

//