2024-05-03 09:47:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_205062 1689 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus LDL receptor related protein associated protein 1 (LRPAP1), mRNA. ACCESSION NM_205062 VERSION NM_205062.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1689) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1689) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAENSK010000074.1. On Sep 23, 2021 this sequence version replaced NM_205062.1. ##Evidence-Data-START## Transcript exon combination :: HAEK01090586.1, HAEL01003627.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-200 JAENSK010000074.1 34388298-34388497 201-345 JAENSK010000074.1 34392850-34392994 346-470 JAENSK010000074.1 34393340-34393464 471-591 JAENSK010000074.1 34394569-34394689 592-750 JAENSK010000074.1 34395559-34395717 751-833 JAENSK010000074.1 34396101-34396183 834-1010 JAENSK010000074.1 34396361-34396537 1011-1689 JAENSK010000074.1 34396872-34397550 FEATURES Location/Qualifiers source 1..1689 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="4" /map="4" gene 1..1689 /gene="LRPAP1" /gene_synonym="RAP" /note="LDL receptor related protein associated protein 1" /db_xref="CGNC:11638" /db_xref="GeneID:395936" exon 1..200 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" misc_feature 9..11 /gene="LRPAP1" /gene_synonym="RAP" /note="upstream in-frame stop codon" CDS 30..1076 /gene="LRPAP1" /gene_synonym="RAP" /note="receptor-associated protein; alpha-2-macroglobulin receptor-associated protein; low density lipoprotein receptor-related protein associated protein 1" /codon_start=1 /product="alpha-2-macroglobulin receptor-associated protein precursor" /protein_id="NP_990393.2" /db_xref="CGNC:11638" /db_xref="GeneID:395936" /translation="
MAATRTLVAVIAAFLAVSARASKYTREANEGLADAKRREAGEFRVVRLNQVWEKAQRLQLSAVKLAELHSDLKIQEKDELSWKKLKAEGLDEDGEKEAKLRRNLNVIMTKYGMNGKKDSHLTDTNYIKDGTESDTLDDPRLEKLWSKAKTSGKFSDEELDKLWREFKHHKEKIREYNILLETVSRTEDIHKNVINPSEENPVKEEVLHNKHRELKEKLRSINQGFERLRKVSHQGYDATSEFEEPRVIDLWDMAKSANFTEKELESFREELKHFEAKIEKHHHYQKQLEISHEKLKHIEGTGDKEHLNRNREKYAMLEEKTKELGYKVKKHLQDLSSRISQGLQHNEL"
sig_peptide 30..92 /gene="LRPAP1" /gene_synonym="RAP" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 48..389 /gene="LRPAP1" /gene_synonym="RAP" /note="Alpha-2-macroglobulin RAP, N-terminal domain; Region: Alpha-2-MRAP_N; pfam06400" /db_xref="CDD:428920" misc_feature 168..197 /gene="LRPAP1" /gene_synonym="RAP" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269813" misc_feature 219..284 /gene="LRPAP1" /gene_synonym="RAP" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269813" misc_feature 315..356 /gene="LRPAP1" /gene_synonym="RAP" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269813" misc_feature 435..1073 /gene="LRPAP1" /gene_synonym="RAP" /note="Alpha-2-macroglobulin RAP, C-terminal domain; Region: Alpha-2-MRAP_C; pfam06401" /db_xref="CDD:428921" exon 201..345 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 346..470 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 471..591 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 592..750 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 751..833 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 834..1010 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" exon 1011..1689 /gene="LRPAP1" /gene_synonym="RAP" /inference="alignment:Splign:2.1.0" ORIGIN
gggactcgtagttccgcgcacggagcgatatggcggcgacgcggacgcttgtggctgttattgccgcgttcctcgccgtcagcgctcgggccagcaagtacacccgggaggccaacgaggggctggctgacgccaagcggcgggaggccggggagttccgggtggtgaggctgaatcaggtctgggagaaagcgcagcggcttcagctctctgctgtgaaactagcagaattacacagtgatctgaaaatacaagaaaaggatgagctaagctggaaaaaactgaaggctgaagggctagatgaagatggagagaaagaagccaagcttagacgcaacttaaatgtcattatgactaaatatggaatgaacggaaagaaggactctcacttaactgatactaactacattaaagatggtacagaaagtgatacactggatgacccaagactggaaaaattatggagcaaggccaagacctctgggaagttctcagatgaggagctggataagctttggcgagaatttaaacatcacaaagaaaagattcgggaatacaatattctgcttgagaccgtgagcagaactgaagatattcacaaaaatgtaatcaacccatctgaagagaacccggtgaaagaggaagtcttgcacaacaaacacagagaacttaaagagaagctaagaagcatcaaccagggctttgaacgtttgcgtaaagtcagtcaccaaggatatgatgcaaccagtgaatttgaagaaccaagagtgattgatttgtgggacatggcaaaatcagccaatttcactgagaaagagctagaatcttttcgggaggagctgaaacactttgaagcaaaaattgaaaaacatcatcactatcagaagcaattagagatttcacatgagaaactaaaacatatagaggggactggagataaggagcatctgaacagaaacagagagaaatatgccatgctagaagaaaagacaaaggagctcggatataaggtaaagaagcatttgcaagacttatccagcagaatctctcaaggtcttcaacacaatgaattataaacatctgttctccttcatgggatcaattgatgatcataaaacaaataacagagggattttaggaacaggattaaccaagcagtccctccgaaattctaaggattgaagagttgtcctgtaagaaaactttctgtggtccacttagttttgtatttgcactgtcacgttaaatgattacattataaatctgaatcaagtaacagcctttgaaataagtcacgtcacaaggaagtgtgaactctcagaagattcctgctagtaaaaaaaaaatactgatcttatagttagtcaaagtattctgatcaatgaaagcagacacctgaggtacaggttgttaaagttcagagaagtttaatatttcattgtttagtttgatgcattttctactgaaggtaattaaatgtttctatgtgctgagcattgactcagagctgcactgtatatgaaccttttgtatgagaagaggaggaggaatgaggaaggaataagtatagaggtcagttcacaaaacttacagactaacatatctgaagttactgaatgtatgtgtacaattgtgtcattcatagttgcttggttttgttacacttagtcattaaaaatcaaaacaaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]