LOCUS       NM_205062               1689 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus LDL receptor related protein associated protein 1
            (LRPAP1), mRNA.
ACCESSION   NM_205062
VERSION     NM_205062.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1689)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1689)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000074.1.
            
            On Sep 23, 2021 this sequence version replaced NM_205062.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01090586.1, HAEL01003627.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-200               JAENSK010000074.1  34388298-34388497
            201-345             JAENSK010000074.1  34392850-34392994
            346-470             JAENSK010000074.1  34393340-34393464
            471-591             JAENSK010000074.1  34394569-34394689
            592-750             JAENSK010000074.1  34395559-34395717
            751-833             JAENSK010000074.1  34396101-34396183
            834-1010            JAENSK010000074.1  34396361-34396537
            1011-1689           JAENSK010000074.1  34396872-34397550
FEATURES             Location/Qualifiers
     source          1..1689
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="4"
                     /map="4"
     gene            1..1689
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="LDL receptor related protein associated protein 1"
                     /db_xref="CGNC:11638"
                     /db_xref="GeneID:395936"
     exon            1..200
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    9..11
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="upstream in-frame stop codon"
     CDS             30..1076
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="receptor-associated protein; alpha-2-macroglobulin
                     receptor-associated protein; low density lipoprotein
                     receptor-related protein associated protein 1"
                     /codon_start=1
                     /product="alpha-2-macroglobulin receptor-associated
                     protein precursor"
                     /protein_id="NP_990393.2"
                     /db_xref="CGNC:11638"
                     /db_xref="GeneID:395936"
                     /translation="

MAATRTLVAVIAAFLAVSARASKYTREANEGLADAKRREAGEFRVVRLNQVWEKAQRLQLSAVKLAELHSDLKIQEKDELSWKKLKAEGLDEDGEKEAKLRRNLNVIMTKYGMNGKKDSHLTDTNYIKDGTESDTLDDPRLEKLWSKAKTSGKFSDEELDKLWREFKHHKEKIREYNILLETVSRTEDIHKNVINPSEENPVKEEVLHNKHRELKEKLRSINQGFERLRKVSHQGYDATSEFEEPRVIDLWDMAKSANFTEKELESFREELKHFEAKIEKHHHYQKQLEISHEKLKHIEGTGDKEHLNRNREKYAMLEEKTKELGYKVKKHLQDLSSRISQGLQHNEL"

     sig_peptide     30..92
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    48..389
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="Alpha-2-macroglobulin RAP, N-terminal domain;
                     Region: Alpha-2-MRAP_N; pfam06400"
                     /db_xref="CDD:428920"
     misc_feature    168..197
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="3-helical coiled coil [structural motif]; Region:
                     3-helical coiled coil"
                     /db_xref="CDD:269813"
     misc_feature    219..284
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="3-helical coiled coil [structural motif]; Region:
                     3-helical coiled coil"
                     /db_xref="CDD:269813"
     misc_feature    315..356
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="3-helical coiled coil [structural motif]; Region:
                     3-helical coiled coil"
                     /db_xref="CDD:269813"
     misc_feature    435..1073
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /note="Alpha-2-macroglobulin RAP, C-terminal domain;
                     Region: Alpha-2-MRAP_C; pfam06401"
                     /db_xref="CDD:428921"
     exon            201..345
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            346..470
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            471..591
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            592..750
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            751..833
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            834..1010
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
     exon            1011..1689
                     /gene="LRPAP1"
                     /gene_synonym="RAP"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gggactcgtagttccgcgcacggagcgatatggcggcgacgcggacgcttgtggctgttattgccgcgttcctcgccgtcagcgctcgggccagcaagtacacccgggaggccaacgaggggctggctgacgccaagcggcgggaggccggggagttccgggtggtgaggctgaatcaggtctgggagaaagcgcagcggcttcagctctctgctgtgaaactagcagaattacacagtgatctgaaaatacaagaaaaggatgagctaagctggaaaaaactgaaggctgaagggctagatgaagatggagagaaagaagccaagcttagacgcaacttaaatgtcattatgactaaatatggaatgaacggaaagaaggactctcacttaactgatactaactacattaaagatggtacagaaagtgatacactggatgacccaagactggaaaaattatggagcaaggccaagacctctgggaagttctcagatgaggagctggataagctttggcgagaatttaaacatcacaaagaaaagattcgggaatacaatattctgcttgagaccgtgagcagaactgaagatattcacaaaaatgtaatcaacccatctgaagagaacccggtgaaagaggaagtcttgcacaacaaacacagagaacttaaagagaagctaagaagcatcaaccagggctttgaacgtttgcgtaaagtcagtcaccaaggatatgatgcaaccagtgaatttgaagaaccaagagtgattgatttgtgggacatggcaaaatcagccaatttcactgagaaagagctagaatcttttcgggaggagctgaaacactttgaagcaaaaattgaaaaacatcatcactatcagaagcaattagagatttcacatgagaaactaaaacatatagaggggactggagataaggagcatctgaacagaaacagagagaaatatgccatgctagaagaaaagacaaaggagctcggatataaggtaaagaagcatttgcaagacttatccagcagaatctctcaaggtcttcaacacaatgaattataaacatctgttctccttcatgggatcaattgatgatcataaaacaaataacagagggattttaggaacaggattaaccaagcagtccctccgaaattctaaggattgaagagttgtcctgtaagaaaactttctgtggtccacttagttttgtatttgcactgtcacgttaaatgattacattataaatctgaatcaagtaacagcctttgaaataagtcacgtcacaaggaagtgtgaactctcagaagattcctgctagtaaaaaaaaaatactgatcttatagttagtcaaagtattctgatcaatgaaagcagacacctgaggtacaggttgttaaagttcagagaagtttaatatttcattgtttagtttgatgcattttctactgaaggtaattaaatgtttctatgtgctgagcattgactcagagctgcactgtatatgaaccttttgtatgagaagaggaggaggaatgaggaaggaataagtatagaggtcagttcacaaaacttacagactaacatatctgaagttactgaatgtatgtgtacaattgtgtcattcatagttgcttggttttgttacacttagtcattaaaaatcaaaacaaga

//