GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 13:31:32, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_204364               1194 bp    mRNA    linear   VRT 27-APR-2025
DEFINITION  Gallus gallus SIX homeobox 3 (SIX3), mRNA.
ACCESSION   NM_204364 XM_015283827
VERSION     NM_204364.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1194)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1194)
  AUTHORS   Bovolenta,P., Mallamaci,A., Puelles,L. and Boncinelli,E.
  TITLE     Expression pattern of cSix3, a member of the Six/sine oculis family
            of transcription factors
  JOURNAL   Mech Dev 70 (1-2), 201-203 (1998)
   PUBMED   9510037
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AADN05000005.1.
            
            On Mar 13, 2018 this sequence version replaced NM_204364.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns
                              SAMEA103992432, SAMEA103992440 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-960               AADN05000005.1     15926059-15927018   c
            961-1194            AADN05000005.1     15923891-15924124   c
FEATURES             Location/Qualifiers
     source          1..1194
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="3"
                     /map="3"
                     /breed="Red Jungle Fowl"
     gene            1..1194
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="SIX homeobox 3"
                     /db_xref="CGNC:49119"
                     /db_xref="GeneID:378786"
     exon            1..960
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    44..46
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="upstream in-frame stop codon"
     CDS             209..1153
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="sine oculis homeobox homolog 3"
                     /codon_start=1
                     /product="homeobox protein SIX3"
                     /protein_id="NP_989695.1"
                     /db_xref="CGNC:49119"
                     /db_xref="GeneID:378786"
                     /translation="
MVFRSPLELYPTHFFLPNFAADPHHRSLLLASGGSGSGSGCSPGAGGGGGSSRAPHEELSMFQLPTLNFSPEQVASVCETLEETGDIERLGRFLWSLPVAPGACEAINKHESILRARAVVAFHTGNFRDLYHILENHKFTKESHGKLQAMWLEAHYQEAEKLRGRPLGPVDKYRVRKKFPLPRTIWDGEQKTHCFKERTRSLLREWYLQDPYPNPSKKRELAQATGLTPTQVGNWFKNRRQRDRAAAAKNRLQHQAIGQSGMRSLAEPGCPTHSSAESPSTAASPTTSVSSLTERAETGTSILSVTSSDSECDV"
     misc_feature    413..754
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="Transcriptional regulator, SIX1, N-terminal SD
                     domain; Region: SIX1_SD; pfam16878"
                     /db_xref="CDD:465293"
     misc_feature    776..922
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(779..781,788..790,908..910,917..922)
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    848..907
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="propagated from UniProtKB/Swiss-Prot (O42406.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    926..1150
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /note="propagated from UniProtKB/Swiss-Prot (O42406.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            961..1194
                     /gene="SIX3"
                     /gene_synonym="CSIX3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggcggcgcggggccgggcgcgtgtgagcgcgtgagtgtgtgcgtgagtgtgtgcgcgtgtgtgtgcgtgcgtgtgccccgcgcctctatgtggctgcgtgtgcgtgtgcgggtgtggatgcgtgcgcggtgcgggtgccctttcctcccttcttcctccctttctttcttttctccgtgatcgctctccccctctccccggtcatcccatggtgttcaggtccccgctagagctctatcccacccatttcttcctgcccaacttcgccgccgacccgcaccaccgctccctccttctcgccagcggcggcagcggcagcggctcgggctgcagccccggggccggcggcggcggcggcagctcccgggcgccccacgaagagttgtcaatgtttcagctgcccacgctcaacttctccccggagcaagtggccagcgtctgcgagacgctggaggagaccggagacatagagaggctggggaggttcctctggtcgctgccggtggcgccgggggcatgcgaggccatcaacaagcacgagtccatcctgcgcgcccgggcggtggtggccttccacacgggcaacttccgcgacctctaccacatcctggagaaccacaaattcaccaaggagtcgcacggcaagctgcaggccatgtggctcgaagcgcactaccaggaggccgagaagctgcggggccgcccgctggggccggttgataaatacagggtgaggaagaagtttccgctgcccaggaccatttgggatggcgagcagaagacgcactgcttcaaggagaggactcgcagcctcctgagggagtggtacctgcaggacccttaccccaatccgagcaagaaaagggaactggctcaggccacggggctcacccccacgcaagtaggcaactggttcaaaaaccgaaggcaaagagacagagcggcggcggctaaaaacaggctccagcaccaggcgataggacagagcggcatgcggtcgttggcagagcccggctgcccgacgcacagctcggccgagtccccgtccacggcggccagcccgaccaccagcgtctccagtttgacagaaagagccgagacgggcacctccatcctctcggtaacctccagcgactcggaatgtgatgtatgatatcggaaaacaaacaaacaaacaaatcacaacaacaacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]