2025-08-23 17:58:09, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NM_001407494 714 bp mRNA linear VRT 03-APR-2025 DEFINITION Gallus gallus homeobox C6 (HOXC6), mRNA. ACCESSION NM_001407494 VERSION NM_001407494.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 714) AUTHORS Ohya,Y.K., Kuraku,S. and Kuratani,S. TITLE Hox code in embryos of Chinese soft-shelled turtle Pelodiscus sinensis correlates with the evolutionary innovation in the turtle JOURNAL J Exp Zool B Mol Dev Evol 304 (2), 107-118 (2005) PUBMED 15643629 REFERENCE 2 (bases 1 to 714) AUTHORS Gaunt,S.J. TITLE Conservation in the Hox code during morphological evolution JOURNAL Int J Dev Biol 38 (3), 549-552 (1994) PUBMED 7848839 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JN129278.1. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-400 JN129278.1 93989-94388 c 401-714 JN129278.1 92483-92796 c FEATURES Location/Qualifiers source 1..714 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="33" /map="33" /breed="Leghorn" gene 1..714 /gene="HOXC6" /gene_synonym="HOXC-6" /note="homeobox C6" /db_xref="CGNC:64714" /db_xref="GeneID:100858368" CDS 1..714 /gene="HOXC6" /gene_synonym="HOXC-6" /note="homeo box C6; homeobox protein C6" /codon_start=1 /product="homeobox C6" /protein_id="NP_001394423.1" /db_xref="CGNC:64714" /db_xref="GeneID:100858368" /translation="
MNSYFTNPSLSCHLTSGQEVLPNVALNSTAYDPVRHFSTYGAAVAQNRIYSSPFYSPQDNVVFSSSRGPYDYGSNAFYQEKDMLSSCRQNSMGHNTQTSIAQDFTSDQNRNTSQEQKTSIQIYPWMQRMNSHSGVGYGADRRRGRQIYSRYQTLELEKEFHFNRYLTRRRRIEIANALCLTERQIKIWFQNRRMKWKKESNLSSTLSGAGGGTAAAAADSLAKEEKREETEEEKQKE"
misc_feature 424..594 /gene="HOXC6" /gene_synonym="HOXC-6" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" ORIGIN
atgaattcctatttcacaaacccatctttatcctgccatctaaccagtggccaagaggtgcttcccaacgtagccctcaattcaactgcctatgaccctgtcaggcatttttctacttatggagcagccgttgctcaaaaccggatttattcttctcctttttattcaccgcaagataatgttgtgtttagctccagccgaggaccttatgactatggatctaatgctttttaccaagaaaaagacatgctttctagctgcaggcaaaattctatgggacataatacacagacatcaatcgcacaggattttaccagtgaccaaaacaggaacacttcgcaagaacaaaaaactagcattcaaatatacccatggatgcagcgtatgaactcccacagtggcgtgggctacggggccgaccgccggcggggccgccagatttattcccgttaccaaacgttggagctggagaaggaatttcacttcaaccgctacctgacgaggcggaggcggatcgaaatcgccaacgctctctgcctgacggaacggcagatcaagatttggttccagaaccgaaggatgaaatggaaaaaagaaagcaacttaagctcgaccctctccggggcgggtggtggaaccgcggccgccgccgccgatagtttggccaaggaggagaagcgagaagagacagaggaggagaagcagaaggagtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]