2025-06-07 15:15:56, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001397000 1689 bp mRNA linear VRT 12-JUN-2024 DEFINITION Gallus gallus homeobox D9 (HOXD9), transcript variant 2, mRNA. ACCESSION NM_001397000 XM_040675620 XM_040703636 VERSION NM_001397000.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1689) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1689) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1689) AUTHORS Izpisua-Belmonte,J.C., Tickle,C., Dolle,P., Wolpert,L. and Duboule,D. TITLE Expression of the homeobox Hox-4 genes and the specification of position in chick wing development JOURNAL Nature 350 (6319), 585-589 (1991) PUBMED 1673231 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000236.1. On or before Oct 29, 2021 this sequence version replaced XM_040703636.1, XM_040675620.1. Transcript Variant: This variant (2) has five exons. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## CDS exon combination :: SRR12888529.111537.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA103992604 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-136 JAENSK010000236.1 8559814-8559949 c 137-269 JAENSK010000236.1 8559032-8559164 c 270-1099 JAENSK010000236.1 8557959-8558788 c 1100-1386 JAENSK010000236.1 8557275-8557561 c 1387-1689 JAENSK010000236.1 8556523-8556825 c FEATURES Location/Qualifiers source 1..1689 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="7" /map="7" gene 1..1689 /gene="HOXD9" /note="homeobox D9" /db_xref="CGNC:56606" /db_xref="GeneID:771214" exon 1..136 /gene="HOXD9" /inference="alignment:Splign:2.1.0" exon 137..269 /gene="HOXD9" /inference="alignment:Splign:2.1.0" exon 270..1099 /gene="HOXD9" /inference="alignment:Splign:2.1.0" misc_feature 421..423 /gene="HOXD9" /note="upstream in-frame stop codon" CDS 442..1341 /gene="HOXD9" /note="chox-4.4; homeobox protein Hox-4.4" /codon_start=1 /product="homeobox protein Hox-D9" /protein_id="NP_001383929.1" /db_xref="CGNC:56606" /db_xref="GeneID:771214" /translation="
MSSSGTISNYYVDSLIGHESEEVYGSRFVQGGHSATSRPSGVAESSDFSSCSFAPKSTVFSTSWSTVHPQPPAAMTGIYHPYMHQPHLGAADAGRYVRSWIEPFPGFPGGGGGSGGGGGGSASGSGSGSSAGRHYGIKPETGAAASSSSSSSSSSSKRTECSSSRESQGIAVPEYTCGTFLPEPREKAAAGSAKEPAACSHSPGPGGEPKEEKQQQLDPNNPAANWIHARSTRKKRCPYTKYQTLELEKEFLFNMYLTRDRRYEVARILNLTERQVKIWFQNRRMKMKKMNKEKGNKGD"
misc_feature 442..1098 /gene="HOXD9" /note="Hox9 activation region; Region: Hox9_act; pfam04617" /db_xref="CDD:461369" misc_feature 1138..1284 /gene="HOXD9" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 1100..1386 /gene="HOXD9" /inference="alignment:Splign:2.1.0" exon 1387..1689 /gene="HOXD9" /inference="alignment:Splign:2.1.0" ORIGIN
gtgttttcgcagtgctgttgtttgtgtcctcagcgggccgtgctgcgggctccactctaactgtgtgcgttttctccagattccgacacagcaccttccctctctcggaggagcagaaaggcgcagcacggcgcgggcaagaatccccccttcccagcgggtttcctcggcagctcggagtgtgattagcaagccaaggccgttggatgtatttaaacaccctgcctctcattgattaagaaatgaatggcagaaatcactcggaggagcagccccagtttagcggattgatttactcgcagtattggtaaatatgatcacgtgggctccgcaaccaatggttgagggttgcagtctgcaaaatactacgattgttctcagggagggtatcatatacagttaacagtgtaaccttttatatgagtaagaggggagcctaaaatgtcgtctagtggcaccataagtaactattatgtcgattctctcataggccatgaaagcgaagaagtttacgggagtagattcgtccaggggggtcacagtgcgacctccaggccatcaggtgtggcagagagttccgatttttcctcctgtagctttgcaccaaaatccaccgtgttctccacctcctggtccacggttcacccgcagccgcccgcggccatgaccgggatctaccacccctacatgcaccagccccacttaggggcagccgacgccggccgctacgtgcgctcctggatcgagcccttcccgggcttcccgggcggcggcggcggcagcggcggcggcggcggcggctccgcgtccggctcgggctcgggctcctccgccgggcgccactacgggataaagccggagacgggagcagccgcctcctcttcttcctcctcctcctcctcctcctccaaaaggactgagtgctcctcgtcccgagagtcccaggggatcgccgtgcccgaatacacgtgcggcactttcctgccggagccccgagagaaggcggccgccggcagcgccaaggagcccgccgcctgcagccacagccccggccccggcggagagccgaaggaggagaagcagcagcaacttgacccaaataaccccgcggcaaactggatccacgctcgttcgacgaggaaaaagcgttgcccctacactaagtatcaaactctggaactggagaaggagtttctctttaacatgtacctcacccgcgaccgccgctacgaagtagctaggattctaaatctcaccgagagacaggtcaaaatctggtttcagaacagacggatgaaaatgaaaaagatgaacaaggagaaaggcaataaaggagactaacgccggggtgggaacgcggccggggagcgcagctctggggctgagtggcttcgatcgacggcagcgctgcgtcgtccgcgattcattgagaggaaatctcgccccaacctctgctttctaggtctaaattttttgcaatagatgccaccgcgaggccacgggatgccccctccaccccacccccttagtgcactgttaggaggtcgtctccgattcgaagccatttgcaataggcctcacgtttcccgagctccggcccggtaaatgctgtgcgcgctcccacgtccctaactgccgacctgctgtatctgtgtccgttctaacacaataaaggctgtcgtgaccgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]