GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-17 19:31:15, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001305103            2675 bp    mRNA    linear   VRT 30-APR-2025
DEFINITION  Gallus gallus ubiquitin specific peptidase 13 (USP13), mRNA.
ACCESSION   NM_001305103 XM_426842
VERSION     NM_001305103.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2675)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2675)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000240.1.
            
            On Dec 3, 2021 this sequence version replaced NM_001305103.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript from the same
            strain was available for the full length of the gene. The extent of
            this transcript is supported by transcript alignments and
            orthologous data.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed sample support SAMEA103992290,
                              SAMEA103992323 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-183               JAENSK010000240.1  17128376-17128558   c
            184-309             JAENSK010000240.1  17120947-17121072   c
            310-370             JAENSK010000240.1  17116210-17116270   c
            371-492             JAENSK010000240.1  17107427-17107548   c
            493-635             JAENSK010000240.1  17106886-17107028   c
            636-820             JAENSK010000240.1  17106495-17106679   c
            821-915             JAENSK010000240.1  17102151-17102245   c
            916-1103            JAENSK010000240.1  17101082-17101269   c
            1104-1175           JAENSK010000240.1  17100302-17100373   c
            1176-1269           JAENSK010000240.1  17099932-17100025   c
            1270-1395           JAENSK010000240.1  17096839-17096964   c
            1396-1549           JAENSK010000240.1  17096311-17096464   c
            1550-1724           JAENSK010000240.1  17095958-17096132   c
            1725-1813           JAENSK010000240.1  17093994-17094082   c
            1814-1936           JAENSK010000240.1  17093560-17093682   c
            1937-1963           JAENSK010000240.1  17093023-17093049   c
            1964-2107           JAENSK010000240.1  17091833-17091976   c
            2108-2274           JAENSK010000240.1  17090722-17090888   c
            2275-2440           JAENSK010000240.1  17090178-17090343   c
            2441-2525           JAENSK010000240.1  17088549-17088633   c
            2526-2675           JAENSK010000240.1  17087751-17087900   c
FEATURES             Location/Qualifiers
     source          1..2675
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="9"
                     /map="9"
     gene            1..2675
                     /gene="USP13"
                     /note="ubiquitin specific peptidase 13"
                     /db_xref="CGNC:6766"
                     /db_xref="GeneID:429286"
     exon            1..183
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     CDS             31..2619
                     /gene="USP13"
                     /EC_number="3.4.19.12"
                     /note="ubiquitin thioesterase 13; deubiquitinating enzyme
                     13; ubiquitin-specific-processing protease 13; ubiquitin
                     specific peptidase 13 (isopeptidase T-3)"
                     /codon_start=1
                     /product="ubiquitin carboxyl-terminal hydrolase 13"
                     /protein_id="NP_001292032.2"
                     /db_xref="CGNC:6766"
                     /db_xref="GeneID:429286"
                     /translation="
MQRAALFGGGDAQMAAGDLGELLVPYMPTIRVPKSGDRVYKTECAFSYDSPDSEGGLYVCMNTFLGFGREHIERHYRKTGQCVYLHLKRHVIEKVPGASGGALPKRRNAKLFLDLEANGDLSSDDFEYEDEAKLVIFPDHYEISLPNIEELPALVTIASDALLSAKSPYRKQDPDSWEEELQASKHAKSLVQLDNGVRIPPSGWKCSKCDLRENLWLNLTDGSVLCGKWFFDGSGGNGHAMEHYKETGYPLAVKLGTITPDGADVYSFDEEEPVLDPHIAKHLAHFGIDMLQMQVAENGLRDNDIKPRVSEWEVIQEAGVKLKPMYGPGYTGMKNLGNSCYLNAVMQAIFSIPEFQRAYVGNLPRIFDYSPLDPTQDFNTQMAKLGHGLLSGQYSKPPMKSELIEQVMKEEHKPQQNGISPQMFKAFISKDHTEFSSNRQQDAQEFFLHLINLVERNPVGSENPSDVFRFLVEERTQCCQSRKVRYTERVDYIMQLPVAMEAATNKDELIAYELKRREAEAARRAPPELVRAKIPFSACLQAFSEPTNVEDFWSSALQAKSAGVKTSRFASFPQYLVVQIKKFTFGLDWIPKKLDVSIDMPDFLDISHLRAMGLQPGEEELPDIAPPIIIPEDPKDRMMNNFVESLDIDESSVMQLAEMGFPLEACRKAVYYTGNLGAEVAFNWIIAHMEEPDFAEPLVVPVFGGAASSGVAGLGAVGLDNQPPEEMVSIIISMGFQRSLAIQALKATNNNLERALEWIFSHPELEEEDGEPALNVMDLENHTNANILAEARSEGPRIKDGPGRYELFGFISHMGTSTMSGHYVCHLKKEGRWVIYNDLRVCASERPPKDLGYIYFYHRIPS"
     misc_feature    118..309
                     /gene="USP13"
                     /note="Variant UBP zinc finger; Region: zf-UBP_var;
                     pfam17807"
                     /db_xref="CDD:407678"
     misc_feature    646..864
                     /gene="USP13"
                     /note="Zn-finger in ubiquitin-hydrolases and other
                     protein; Region: zf-UBP; pfam02148"
                     /db_xref="CDD:460464"
     misc_feature    1024..2601
                     /gene="USP13"
                     /note="A subfamily of Peptidase C19. Peptidase C19
                     contains ubiquitinyl hydrolases. They are intracellular
                     peptidases that remove ubiquitin molecules from
                     polyubiquinated peptides by cleavage of isopeptide bonds.
                     They hydrolyze bonds involving the carboxyl...; Region:
                     Peptidase_C19B; cd02658"
                     /db_xref="CDD:239123"
     misc_feature    order(1033..1035,1048..1050,2494..2496,2542..2544)
                     /gene="USP13"
                     /note="active site"
                     /db_xref="CDD:239123"
     misc_feature    1969..2115
                     /gene="USP13"
                     /note="UBA1 domain found in ubiquitin carboxyl-terminal
                     hydrolase 13 (UBP13); Region: UBA1_UBP13; cd14384"
                     /db_xref="CDD:270567"
     misc_feature    2197..2322
                     /gene="USP13"
                     /note="UBA2 domain found in ubiquitin carboxyl-terminal
                     hydrolase 5 (UBP5); Region: UBA2_UBP5; cd14386"
                     /db_xref="CDD:270569"
     misc_feature    order(2272..2274,2287..2292,2299..2304,2311..2316)
                     /gene="USP13"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270569"
     exon            184..309
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            310..370
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            371..492
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            493..635
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            636..820
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            821..915
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            916..1103
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1104..1175
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1176..1269
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1270..1395
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1396..1549
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1550..1724
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1725..1813
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1814..1936
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1937..1963
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            1964..2107
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            2108..2274
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            2275..2440
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            2441..2525
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
     exon            2526..2675
                     /gene="USP13"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccgcccgccgtccggaggcaggcaggcggcatgcagcgggccgcgctgttcggcggcggcgacgcgcagatggcggccggggacctgggcgagctgctcgtcccctacatgcccaccatccgcgtgcccaagtccggggaccgggtctacaagacggagtgtgccttctcctacgactctcccgattcagaaggaggtctctatgtgtgcatgaacacgtttctgggatttggaagggaacacattgaaaggcattaccggaaaacaggacagtgtgtatatttgcatctgaaacgacatgtgatagagaaggtaccaggggcatctggtggagctttaccaaaaaggaggaatgctaagctatttttagatctagaggcaaatggtgatctgagcagtgatgattttgaatatgaagatgaagcaaaactcgttatatttcctgatcactatgaaatttcattaccaaacatagaagagttaccagcactggtgacaatagcttctgatgcactcctcagtgcaaaatcaccctacaggaagcaggaccctgactcttgggaagaagagctacaggcatctaagcatgccaaatcgcttgtgcagctagacaacggtgttagaattccccccagtggttggaagtgctcaaaatgtgatcttcgggagaatctgtggctaaacctgacagatggttcagtgttgtgcgggaagtggttctttgatggtagtggagggaatggtcacgcaatggagcactacaaggagacgggttatcccctggcagtgaagttgggaaccatcactcctgatggagcagatgtctattcctttgatgaagaggagccggttttagatccacatatagcaaagcatctggcacactttgggattgatatgctacagatgcaagtggcagagaatggtctaagagataatgatataaaaccaagagtctctgaatgggaagtgattcaggaagctggtgtgaaactcaagcccatgtatggcccaggatataccggcatgaagaacctgggaaatagctgctacctcaacgctgtcatgcaagccattttcagcatcccagagttccagcgagcgtatgtgggaaaccttccgagaatatttgactactccccgcttgatccaacacaagatttcaacactcagatggctaaactgggacatggtctcctttcaggccagtattctaaaccacccatgaaatctgagcttattgaacaggtgatgaaagaagaacacaagcctcaacaaaatggaatatctccccagatgtttaaggcttttataagtaaagaccacacagaattttcctctaatagacaacaagatgcacaggaatttttcctacatcttataaatctagtagagaggaatcctgtaggttcagaaaaccccagtgatgttttccgtttcctggtggaagagcgcacacaatgctgccagtccagaaaagtccgctacactgagagggtagactatatcatgcagttacctgttgccatggaggcggcaacaaacaaagatgaattaattgcatatgagctgaaaaggcgagaagcagaagctgcaaggagagctccaccagaacttgtccgtgccaagatcccatttagtgcatgtttgcaggccttctctgaaccaaccaatgtagaagacttctggagcagtgcccttcaagcaaaatctgcaggagttaagacttctcgttttgcttcatttcctcagtacttagtggtgcagattaagaagttcacctttggccttgactggatacccaaaaagcttgatgtttcgatagacatgccagatttcttagatatcagccaccttcgagccatgggcctccagccaggagaagaggaacttcctgacattgctcctcccattatcattcccgaagacccaaaagatcgtatgatgaacaattttgtggagtctctagatattgatgagtcttcggttatgcaactggcagagatgggttttcctttggaagcatgtcggaaagctgtgtactatacaggcaacctgggtgctgaagtggctttcaactggatcattgcacatatggaagagccagactttgctgagccattggttgtacctgtgtttggaggagctgcttccagtggtgtggctggcttaggggctgttggattggataatcaacctcctgaagagatggtctccatcatcatttccatgggcttccaaaggagcttagcaattcaagctctgaaggcaacaaacaataacttggagcgtgcactggaatggatcttcagccaccctgaattagaggaggaagatggggagcctgctttgaacgtgatggatttggagaaccatacaaatgcgaatatccttgcagaggcaagatcagagggacccaggatcaaagatgggcctggaaggtacgagctgtttgggttcatcagccacatgggaacatccacaatgagtggtcactatgtttgtcatctcaaaaaagaaggaagatgggtgatctacaatgaccttagagtctgtgcctcagaacgacctcccaaagatctgggctacatctatttttaccacaggataccaagttagacctcaaatgtattatctggccttaagaagccgtaagcctttttaacctgccaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]