GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 10:04:12, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001277724            1903 bp    mRNA    linear   VRT 30-APR-2025
DEFINITION  Gallus gallus paired related homeobox 1 (PRRX1), mRNA.
ACCESSION   NM_001277724 NM_001007821
VERSION     NM_001277724.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1903)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1903)
  AUTHORS   Doufexi,A.E. and Mina,M.
  TITLE     Signaling pathways regulating the expression of Prx1 and Prx2 in
            the chick mandibular mesenchyme
  JOURNAL   Dev Dyn 237 (11), 3115-3127 (2008)
   PUBMED   18942149
  REMARK    GeneRIF: Signaling pathways regulating the expression of Prx1 and
            Prx2 in the chick mandibular mesenchyme.
REFERENCE   3  (bases 1 to 1903)
  AUTHORS   Carre,W., Wang,X., Porter,T.E., Nys,Y., Tang,J., Bernberg,E.,
            Morgan,R., Burnside,J., Aggrey,S.E., Simon,J. and Cogburn,L.A.
  TITLE     Chicken genomics resource: sequencing and annotation of 35,407 ESTs
            from single and multiple tissue cDNA libraries and CAP3 assembly of
            a chicken gene index
  JOURNAL   Physiol Genomics 25 (3), 514-524 (2006)
   PUBMED   16554550
REFERENCE   4  (bases 1 to 1903)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   5  (bases 1 to 1903)
  AUTHORS   Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M.
  TITLE     A set of Hox proteins interact with the Maf oncoprotein to inhibit
            its DNA binding, transactivation, and transforming activities
  JOURNAL   J Biol Chem 276 (1), 819-826 (2001)
   PUBMED   11036080
REFERENCE   6  (bases 1 to 1903)
  AUTHORS   Leussink,B., Brouwer,A., el Khattabi,M., Poelmann,R.E.,
            Gittenberger-de Groot,A.C. and Meijlink,F.
  TITLE     Expression patterns of the paired-related homeobox genes MHox/Prx1
            and S8/Prx2 suggest roles in development of the heart and the
            forebrain
  JOURNAL   Mech Dev 52 (1), 51-64 (1995)
   PUBMED   7577675
REFERENCE   7  (bases 1 to 1903)
  AUTHORS   Kuratani,S., Martin,J.F., Wawersik,S., Lilly,B., Eichele,G. and
            Olson,E.N.
  TITLE     The expression pattern of the chick homeobox gene gMHox suggests a
            role in patterning of the limbs and face and in
            compartmentalization of somites
  JOURNAL   Dev Biol 161 (2), 357-369 (1994)
   PUBMED   7906232
REFERENCE   8  (bases 1 to 1903)
  AUTHORS   Nohno,T., Koyama,E., Myokai,F., Taniguchi,S., Ohuchi,H., Saito,T.
            and Noji,S.
  TITLE     A chicken homeobox gene related to Drosophila paired is
            predominantly expressed in the developing limb
  JOURNAL   Dev Biol 158 (1), 254-264 (1993)
   PUBMED   8101172
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000237.1.
            
            On Oct 4, 2021 this sequence version replaced NM_001277724.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEL01007439.1, SRR13267655.53462.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109051 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-498               JAENSK010000237.1  4867768-4868265     c
            499-674             JAENSK010000237.1  4842696-4842871     c
            675-856             JAENSK010000237.1  4841941-4842122     c
            857-1903            JAENSK010000237.1  4835983-4837029     c
FEATURES             Location/Qualifiers
     source          1..1903
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="8"
                     /map="8"
     gene            1..1903
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="paired related homeobox 1"
                     /db_xref="CGNC:48968"
                     /db_xref="GeneID:373941"
     exon            1..498
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    90..92
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="upstream in-frame stop codon"
     CDS             258..995
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="paired-related homeotic gene product; homeobox
                     protein MHOX; paired-related homeobox protein 1;
                     transcription factor Prx1b"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 1"
                     /protein_id="NP_001264653.1"
                     /db_xref="CGNC:48968"
                     /db_xref="GeneID:373941"
                     /translation="
MASSYAHAMERQALLPARLDGPAGLDNLQAKKNFSVSHLLDLEEAGDMVAAQGDEGGGEPGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLASKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSTTCTNASPAQGMNMANSIANLRLKAKEYSLQRNQVPTVN"
     misc_feature    405..566
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q05437.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    552..710
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    909..962
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     misc_feature    921..962
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q05437.2);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     exon            499..674
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /inference="alignment:Splign:2.1.0"
     exon            675..856
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /inference="alignment:Splign:2.1.0"
     exon            857..1903
                     /gene="PRRX1"
                     /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
acagccaccgttctcctcccggccggcggcagctcctggcgccccgagccggcctctctctcccctccggcatgttttaaggccggccctagcagctctccgttgggctttccttccagccgccccaccgccgtcgggtccccgttccccccgccctcgggccgtgcgcttcccccctcgaagggccggcggctggggggggagcgggggcggtgggcgccgggggggcgagggcagaaaagcccccgctcggcaccatggcgtccagctatgcccacgccatggagaggcaggccctgctgccagcccgcctcgacggccccgccggcctggacaatttacaagccaagaagaacttttccgtgagtcacctgctggacctggaggaggcgggcgacatggtggccgcgcagggggacgagggcggcggcgagcccggccggagcttgttggagtcccccgggctgaccagcggcagcgacaccccgcagcaggacaatgatcagctgaattcagaagagaagaagaaaaggaagcagagaaggaacaggactaccttcaacagcagccagctccaggcactagagagggtctttgagaggacacactaccccgatgcctttgtacgggaagaccttgcacgcagagtcaacctcactgaagccagagttcaggtgtggttccagaaccggagagccaagtttcgccggaatgagagggccatgctggccagcaagaacgcctctctgctcaaatcctactcaggggatgtgaccgccgtggagcagcccatagtacctcgcccagctccaagacccaccgactatctctcctggggtaccgcctcgccttacagtgccatggccacctactccaccacgtgtaccaacgccagcccggcgcagggcatgaatatggccaacagtattgccaacctgagactgaaggcaaaagaatatagtttacagaggaatcaagtgcccacagtcaattaatgactgggggcagctgcttcgcagaaggagaaaatacgacagcacccgtcctgcttcgcaacttctgtgctgaaatttaaaaaaatatattaaaaaatattaaaaaaaagaaaaaaggaaaaaaaaataaaaaaagccaaccccaacccagaactgaacattgggaccaaagcgggagcaaactgaaccgctcgagtgacaaggttcctccttccttttgggataatgccaccattttttttcttgttattgtcaggtttattgcttctgctcaatatactacgagcttcttcagttaaggacagtctcacccttgttgttttccatttttgtatgggactgcaaaaagaaaccttcgctgatctcagcccgcggccgcctcccacccaacaccgcgctgaggctcaaagcttgctcccccaccccagctcaccctagaagaagaaattgtttggtcaccgctttccgttgtatccacctgaccttccgtcccctcccacgtcccttgtgccacagaggcagtgccgttgatgttgactgcgagaagcccattgggcgcgatgggctgggaagcatccctgctgggtcgcctggaccacgacgcaaggaagatctctgtgggcttcgcacactttgtcagcgcctggaaaagccagagaagagagaaaagccaatgtgtgtttgtgagtggggggggggaggatggagaagggtttgctctgtagtgccaagaataggactgttaggacactcctttccatgccttacggcttgtgccacagggagaggcgttgtccagatgcatttgttttatatatactgtatatatttatatatataagatatacatgcaagcttggttggtgttttttattaaacgaaataaaatccattgaaaatgctcggga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]