2024-05-03 07:27:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001277112 1063 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus mitochondrial ribosomal protein L46 (MRPL46), mRNA. ACCESSION NM_001277112 XM_413872 VERSION NM_001277112.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1063) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000245.1. On Sep 23, 2021 this sequence version replaced NM_001277112.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: DR420175.1, BU329558.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-250 JAENSK010000245.1 12726060-12726309 251-446 JAENSK010000245.1 12726565-12726760 447-620 JAENSK010000245.1 12727311-12727484 621-1063 JAENSK010000245.1 12728139-12728581 FEATURES Location/Qualifiers source 1..1063 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="10" /map="10" gene 1..1063 /gene="MRPL46" /note="mitochondrial ribosomal protein L46" /db_xref="CGNC:5117" /db_xref="GeneID:415499" exon 1..250 /gene="MRPL46" /inference="alignment:Splign:2.1.0" CDS 11..871 /gene="MRPL46" /codon_start=1 /product="large ribosomal subunit protein mL46" /protein_id="NP_001264041.1" /db_xref="CGNC:5117" /db_xref="GeneID:415499" /translation="
MAALGGKMAAPSSGLCGFRRSAMAARVWWAAGCGRRLSTAPPAAAPRPWKLFGALCLLRLPRITQPLRKEEEEMAALMEQIELEKSHYSDHEIRKLEEEEQLRRRKESLHDDDNEGLGRTVVMAQDLEEKWEQKLLQFSPAPRVTDADKKNDRTSLNRKLDSNLMLLVKQKIGNQELWLLPQVEWQPGETLRSTVERAMATFLGDHIQAKILGNAPYGIYKYKFPRAIRTEDNVGAKVFFYKAFLQSSDLSQAELKKDYLWVTKDELGDYLKSEYLKKVNRFLLDL"
misc_feature 155..454 /gene="MRPL46" /note="39S mitochondrial ribosomal protein L46; Region: MRP-L46; pfam11788" /db_xref="CDD:432074" misc_feature 461..856 /gene="MRPL46" /note="Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447" /db_xref="CDD:444909" misc_feature order(557..565,578..604) /gene="MRPL46" /note="nudix motif; other site" /db_xref="CDD:239217" exon 251..446 /gene="MRPL46" /inference="alignment:Splign:2.1.0" exon 447..620 /gene="MRPL46" /inference="alignment:Splign:2.1.0" exon 621..1063 /gene="MRPL46" /inference="alignment:Splign:2.1.0" ORIGIN
gggaggaaagatggcggcgctgggaggaaagatggctgcgcccagttcggggctctgcgggttccgccgaagcgcgatggcggcgcgcgtgtggtgggctgcggggtgcggccggcggctgagcaccgctcctcccgctgctgctccccggccgtggaagctcttcggggccctgtgcctgctgaggctgccccgcatcacgcagcccctccggaaggaggaagaggagatggcggccctcatggagcagatagagctggagaaaagccactactccgaccacgaaatccgcaagctggaggaggaggagcagctcagaaggaggaaggaaagcttgcatgatgatgacaacgaagggctgggcagaacggttgttatggctcaggacctggaggagaagtgggaacagaagctgctgcagttcagcccagccccgcgggttacagatgctgataaaaaaaacgatcgaacatcattgaacagaaagctggacagtaacctgatgttgctggtgaaacagaaaattggtaaccaagagctgtggctcctgcctcaagtggaatggcagcctggagagactctgcgaagcacagttgagcgagccatggctacgtttttaggcgatcacattcaagccaaaatcctggggaatgcaccatatgggatttacaagtataaattccccagggccatcaggactgaggataacgtgggagccaaagtattcttctacaaagccttcctccaaagcagtgatttgtcccaggcagagctgaagaaagattatctgtgggttacaaaggatgagctgggagattacttgaagtcggaatacctgaaaaaagtcaatcgattccttctggacttataagtgataggctgtgctcaggcagatggggaagatgtggaatgtgactctggggaggagcacagctgctgctttgtgtggtctgtgtgaatgggatgttaaacaggactctggaggataaattgcctttgccttatttcccagttctcttcaccaggcctgtattaaataaatattaaaactttatactcccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]