LOCUS       NM_001048076            2040 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus vimentin (VIM), mRNA.
ACCESSION   NM_001048076 XM_418622
VERSION     NM_001048076.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2040)
  AUTHORS   Yoshida Y, Wang Z, Tehrani KF, Pendleton EG, Tanaka R, Mortensen
            LJ, Nishimura S, Tabata S, Liu HX and Kawabata F.
  TITLE     Bitter taste receptor T2R7 and umami taste receptor subunit T1R1
            are expressed highly in Vimentin-negative taste bud cells in
            chickens
  JOURNAL   Biochem Biophys Res Commun 511 (2), 280-286 (2019)
   PUBMED   30782484
  REMARK    GeneRIF: 3D-reconstructed images clearly revealed that high levels
            of taste receptor type 2 member 7 and T1R1 were expressed in
            Vimentin-negative taste bud cells.
REFERENCE   2  (bases 1 to 2040)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   3  (bases 1 to 2040)
  AUTHORS   Walker JL, Bleaken BM, Romisher AR, Alnwibit AA and Menko AS.
  TITLE     In wound repair vimentin mediates the transition of mesenchymal
            leader cells to a myofibroblast phenotype
  JOURNAL   Mol Biol Cell 29 (13), 1555-1570 (2018)
   PUBMED   29718762
  REMARK    GeneRIF: These findings suggest a novel role for extracellular,
            cell-surface-associated vimentin in mediating repair-cell function
            in wound repair and in transitioning these cells to a myofibroblast
            phenotype.
REFERENCE   4  (bases 1 to 2040)
  AUTHORS   Kommata V and Dermon CR.
  TITLE     Transient vimentin expression during the embryonic development of
            the chicken cerebellum
  JOURNAL   Int J Dev Neurosci 65, 11-20 (2018)
   PUBMED   29030097
  REMARK    GeneRIF: The dats of this study support the possible role of
            vimentin+ fibers in the structural events of cerebellum
            corticogenesis, suggesting the participation of radial/Bergmann
            glia in chicken cerebellum foliation.
REFERENCE   5  (bases 1 to 2040)
  AUTHORS   Venkatesan N, Rajapaksha P, Payne J, Goodfellow F, Wang Z, Kawabata
            F, Tabata S, Stice S, Beckstead R and Liu HX.
  TITLE     Distribution of alpha-Gustducin and Vimentin in premature and
            mature taste buds in chickens
  JOURNAL   Biochem Biophys Res Commun 479 (2), 305-311 (2016)
   PUBMED   27639649
  REMARK    GeneRIF: analysis of alpha-Gustducin and Vimentin distribution in
            premature and mature taste buds in chickens
REFERENCE   6  (bases 1 to 2040)
  AUTHORS   Benes P, Maceckova V, Zdrahal Z, Konecna H, Zahradnickova E, Muzik
            J and Smarda J.
  TITLE     Role of vimentin in regulation of monocyte/macrophage
            differentiation
  JOURNAL   Differentiation 74 (6), 265-276 (2006)
   PUBMED   16831196
  REMARK    GeneRIF: These findings document that up-regulation of vimentin
            gene expression is important for formation of fully active
            macrophage-like cells and macrophage polykaryons
REFERENCE   7  (bases 1 to 2040)
  AUTHORS   Boardman PE, Sanz-Ezquerro J, Overton IM, Burt DW, Bosch E, Fong
            WT, Tickle C, Brown WR, Wilson SA and Hubbard SJ.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   8  (bases 1 to 2040)
  AUTHORS   Zehner,Z.E., Li,Y., Roe,B.A., Paterson,B.M. and Sax,C.M.
  TITLE     The chicken vimentin gene. Nucleotide sequence, regulatory
            elements, and comparison to the hamster gene
  JOURNAL   J Biol Chem 262 (17), 8112-8120 (1987)
   PUBMED   3036797
REFERENCE   9  (bases 1 to 2040)
  AUTHORS   Zehner,Z.E. and Paterson,B.M.
  TITLE     The chicken vimentin gene: aspects of organization and
            transcription during myogenesis
  JOURNAL   Ann N Y Acad Sci 455, 79-94 (1985)
   PUBMED   3909887
  REMARK    Review article
REFERENCE   10 (bases 1 to 2040)
  AUTHORS   Zehner,Z.E. and Paterson,B.M.
  TITLE     Characterization of the chicken vimentin gene: single copy gene
            producing multiple mRNAs
  JOURNAL   Proc Natl Acad Sci U S A 80 (4), 911-915 (1983)
   PUBMED   6573660
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000036.1.
            
            On Sep 23, 2021 this sequence version replaced NM_001048076.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01043492.1, HAEL01000258.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2812696, SAMEA3109052
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-618               JAENSK010000036.1  11858718-11859335   c
            619-679             JAENSK010000036.1  11858559-11858619   c
            680-775             JAENSK010000036.1  11855109-11855204   c
            776-937             JAENSK010000036.1  11854804-11854965   c
            938-1063            JAENSK010000036.1  11854223-11854348   c
            1064-1284           JAENSK010000036.1  11853386-11853606   c
            1285-1328           JAENSK010000036.1  11853248-11853291   c
            1329-1414           JAENSK010000036.1  11852738-11852823   c
            1415-2040           JAENSK010000036.1  11851623-11852248   c
FEATURES             Location/Qualifiers
     source          1..2040
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
     gene            1..2040
                     /gene="VIM"
                     /note="vimentin"
                     /db_xref="CGNC:51275"
                     /db_xref="GeneID:420519"
     exon            1..618
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     CDS             74..1456
                     /gene="VIM"
                     /note="vimentin C-terminus"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_001041541.2"
                     /db_xref="CGNC:51275"
                     /db_xref="GeneID:420519"
                     /translation="

MSFTSSKNSSYRRMFGGGSRPSSGTRYITSSTRYSLGSALRPSSARYVSASPGGVYATKATSVRLRSSMPPMRMHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPIVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"

     misc_feature    74..154
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    77..340
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Head"
     misc_feature    98..358
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    341..448
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 1A"
     misc_feature    359..1285
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     misc_feature    449..514
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Linker 1"
     misc_feature    515..790
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 1B"
     misc_feature    791..859
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Linker 12"
     misc_feature    860..1276
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 2"
     misc_feature    1106..1108
                     /gene="VIM"
                     /note="Stutter. /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P09654.2); other site"
     misc_feature    1277..1453
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Tail"
     exon            619..679
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            680..775
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            776..937
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            938..1063
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1064..1284
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1285..1328
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1329..1414
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1415..2040
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gctcttcttcgcccgccgcgctccgagccccgctccgctcccggattacaaagccgctccgttcctcgccgccatgagcttcaccagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcagcggcacccgctacatcacgtccagcacccgctattccctgggcagcgccctgcggcccagcagcgcccgctacgtgtccgcctcgcccggcggcgtgtacgccaccaaggcgacgtcggtgcggctgcggagcagcatgccgcccatgcggatgcacgacgccgtggacttcaccctggcggacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtagagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaaaggcacgtcccgcttgggcgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctgaccaacgacaaggcccgcgtcgaggtggagcgcgacaacctggccgacgacatcatgcgcctgcgggagaagttgcaggaggagatgctgcagcgggaggaggccgagagcaccctgcagtccttccgacaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagaaattgtcttcttgaagaagcttcatgatgaggaaatccgggaactgcaggctcaactccaggaacagcacatccaaatcgatatggatgtttctaagcctgatcttactgctgccctgcgcgatgttcgtcaacaatatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctccgaagctgctaataggaacaatgatgccctgcgccaggccaaacaagaagctaatgaatatcgcagacagattcagtctctcacctgtgaagttgatgcccttaaaggaagtaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaggacactattggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgctacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaattgttgacactcactcgaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggttttaaaaagttcatgtcttaaaggaagaaacagctttcaagtgcctttctccagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaatttaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttaacttcatgactttctgcaaagccataacttaatgctggaattactatacggttgacaactccagtactgattgtgtggaatattgttttcagattaactagacaaattgtcttcccatctactgcttaggttttggaaccaattaaaatggactataactggcagatgcataatgtattgatacttatcagttgaataaaatgatacttcaagctaataaaaattaatcttgctttcata

//