LOCUS       NM_001006189            1395 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus proteasome 26S subunit, non-ATPase 9 (PSMD9),
            transcript variant 1, mRNA.
ACCESSION   NM_001006189 XM_415145
VERSION     NM_001006189.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1395)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1395)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1395)
  AUTHORS   Caldwell RB, Kierzek AM, Arakawa H, Bezzubov Y, Zaim J, Fiedler P,
            Kutter S, Blagodatski A, Kostovska D, Koter M, Plachy J, Carninci
            P, Hayashizaki Y and Buerstedde JM.
  TITLE     Full-length cDNAs from chicken bursal lymphocytes to facilitate
            gene function analysis
  JOURNAL   Genome Biol 6 (1), R6 (2005)
   PUBMED   15642098
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000260.1.
            
            On Oct 6, 2021 this sequence version replaced NM_001006189.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AJ720363.1, HAEK01013376.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-138               JAENSK010000260.1  5708048-5708185
            139-241             JAENSK010000260.1  5708260-5708362
            242-429             JAENSK010000260.1  5708542-5708729
            430-531             JAENSK010000260.1  5709306-5709407
            532-620             JAENSK010000260.1  5709559-5709647
            621-1395            JAENSK010000260.1  5709979-5710753
FEATURES             Location/Qualifiers
     source          1..1395
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="15"
                     /map="15"
     gene            1..1395
                     /gene="PSMD9"
                     /note="proteasome 26S subunit, non-ATPase 9"
                     /db_xref="CGNC:3203"
                     /db_xref="GeneID:416853"
     exon            1..138
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
     CDS             25..648
                     /gene="PSMD9"
                     /note="isoform 1 is encoded by transcript variant 1; 26S
                     proteasome non-ATPase regulatory subunit 9; proteasome
                     (prosome, macropain) 26S subunit, non-ATPase, 9"
                     /codon_start=1
                     /product="26S proteasome non-ATPase regulatory subunit 9
                     isoform 1"
                     /protein_id="NP_001006189.2"
                     /db_xref="CGNC:3203"
                     /db_xref="GeneID:416853"
                     /translation="

MSEDGSGRAMTLGEVQQLVRRKDELEAQIRACYQLLEDQKGVGMDGPLVDAEGFPRADIDLYQVRAARHSIACLQNDHKALMKQVEEALHQLHAREKEKHARDEAEARAEAMSQSLPPAFAKVNAVTPESPASTSGLQVDDEIVEFGSVNVHNFKSLQNIATVVQHSEGRPLSVTVIRNGKKVHLGLTPKRWAGKGLLGCNIIPLQR"

     misc_feature    67..306
                     /gene="PSMD9"
                     /note="Nas2 N_terminal domain; Region: Nas2_N; pfam18265"
                     /db_xref="CDD:436373"
     misc_feature    355..591
                     /gene="PSMD9"
                     /note="PDZ domain of bacterial and plant zinc
                     metalloprotases, presumably membrane-associated or
                     integral membrane proteases, which may be involved in
                     signalling and regulatory mechanisms. May be responsible
                     for substrate recognition and/or binding, as most PDZ...;
                     Region: PDZ_metalloprotease; cd00989"
                     /db_xref="CDD:238489"
     exon            139..241
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
     exon            242..429
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
     exon            430..531
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
     exon            532..620
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
     exon            621..1395
                     /gene="PSMD9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gcggcacggcgcggtgccgccgccatgtcggaggacgggtcgggccgcgccatgacgctgggcgaggtgcagcagctggtgcggcgtaaggacgagctggaggcgcagatccgggcctgctaccagctcctggaggaccaaaagggcgtgggtatggacgggccgctggtggacgccgagggcttcccccgggccgacatcgatctgtaccaagtgcgcgccgcgcggcacagcatcgcctgtctgcagaacgaccacaaggctctgatgaagcaggtggaggaggctcttcaccagctgcacgcccgggagaaggagaagcacgccagggatgaggcagaggcacgggctgaggccatgagccagagcctgccacctgcctttgccaaagtcaatgctgtgacgccggagtctcctgccagcacctcgggccttcaggttgatgatgagattgtggagtttggttccgtcaatgtgcacaacttcaagagcctgcagaacattgccacagtagtacagcacagtgaaggaagacctctgagtgtgactgtgatccgcaacggcaagaaagtgcacctggggctgactccaaagcgctgggctgggaagggcctcctgggctgcaatatcattcccttgcaaagatgaccacagctcagaagacaataaaaatgaagcttgtgcctgctttctggactctgatttggtttgaaagcttgccctaagatctttgtttttgctgaaatgagtgtttcggaggctgtgacctctaggtggctgggcttgcagagtctgaagaggttctgttggagcagggccttaatgcagatggaattgcactggtttgtggggagcaactcacagagttgcaggatgtggcttctcatctcttgtgccttgcatcagtttggagtaaggctggagtgtaactcagatttcacttgagacagatttggaggagcatagaatgcttttatgtggtgataacgtggcattccttcttttttgttgtttctctgtgaaattcctcactgaacatcttgtaaaataggataaaaagacctggaacaattttttcttttttttaaattagtagatcacagtcaaggaacgtgcaaatctggcactttgtccttcccatgtgagcacagctgttggaagtcactaaataagatagcatttttggaatgcctaattattttaagttaatgaaatcagcattggggttataactctgtcttttaatgtattgaagtactcttaaattttttatttgctgcagttgattttggggtgtatgaacacttcagggggggttggggtgatcttgtttgtaaggttgtttccagttgaactttgaaattctcatcccaatgaataaaactgagtgatgtc

//