2024-05-03 02:13:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001006189 1395 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus proteasome 26S subunit, non-ATPase 9 (PSMD9), transcript variant 1, mRNA. ACCESSION NM_001006189 XM_415145 VERSION NM_001006189.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1395) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1395) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1395) AUTHORS Caldwell RB, Kierzek AM, Arakawa H, Bezzubov Y, Zaim J, Fiedler P, Kutter S, Blagodatski A, Kostovska D, Koter M, Plachy J, Carninci P, Hayashizaki Y and Buerstedde JM. TITLE Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis JOURNAL Genome Biol 6 (1), R6 (2005) PUBMED 15642098 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000260.1. On Oct 6, 2021 this sequence version replaced NM_001006189.1. ##Evidence-Data-START## Transcript exon combination :: AJ720363.1, HAEK01013376.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-138 JAENSK010000260.1 5708048-5708185 139-241 JAENSK010000260.1 5708260-5708362 242-429 JAENSK010000260.1 5708542-5708729 430-531 JAENSK010000260.1 5709306-5709407 532-620 JAENSK010000260.1 5709559-5709647 621-1395 JAENSK010000260.1 5709979-5710753 FEATURES Location/Qualifiers source 1..1395 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="15" /map="15" gene 1..1395 /gene="PSMD9" /note="proteasome 26S subunit, non-ATPase 9" /db_xref="CGNC:3203" /db_xref="GeneID:416853" exon 1..138 /gene="PSMD9" /inference="alignment:Splign:2.1.0" CDS 25..648 /gene="PSMD9" /note="isoform 1 is encoded by transcript variant 1; 26S proteasome non-ATPase regulatory subunit 9; proteasome (prosome, macropain) 26S subunit, non-ATPase, 9" /codon_start=1 /product="26S proteasome non-ATPase regulatory subunit 9 isoform 1" /protein_id="NP_001006189.2" /db_xref="CGNC:3203" /db_xref="GeneID:416853" /translation="
MSEDGSGRAMTLGEVQQLVRRKDELEAQIRACYQLLEDQKGVGMDGPLVDAEGFPRADIDLYQVRAARHSIACLQNDHKALMKQVEEALHQLHAREKEKHARDEAEARAEAMSQSLPPAFAKVNAVTPESPASTSGLQVDDEIVEFGSVNVHNFKSLQNIATVVQHSEGRPLSVTVIRNGKKVHLGLTPKRWAGKGLLGCNIIPLQR"
misc_feature 67..306 /gene="PSMD9" /note="Nas2 N_terminal domain; Region: Nas2_N; pfam18265" /db_xref="CDD:436373" misc_feature 355..591 /gene="PSMD9" /note="PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989" /db_xref="CDD:238489" exon 139..241 /gene="PSMD9" /inference="alignment:Splign:2.1.0" exon 242..429 /gene="PSMD9" /inference="alignment:Splign:2.1.0" exon 430..531 /gene="PSMD9" /inference="alignment:Splign:2.1.0" exon 532..620 /gene="PSMD9" /inference="alignment:Splign:2.1.0" exon 621..1395 /gene="PSMD9" /inference="alignment:Splign:2.1.0" ORIGIN
gcggcacggcgcggtgccgccgccatgtcggaggacgggtcgggccgcgccatgacgctgggcgaggtgcagcagctggtgcggcgtaaggacgagctggaggcgcagatccgggcctgctaccagctcctggaggaccaaaagggcgtgggtatggacgggccgctggtggacgccgagggcttcccccgggccgacatcgatctgtaccaagtgcgcgccgcgcggcacagcatcgcctgtctgcagaacgaccacaaggctctgatgaagcaggtggaggaggctcttcaccagctgcacgcccgggagaaggagaagcacgccagggatgaggcagaggcacgggctgaggccatgagccagagcctgccacctgcctttgccaaagtcaatgctgtgacgccggagtctcctgccagcacctcgggccttcaggttgatgatgagattgtggagtttggttccgtcaatgtgcacaacttcaagagcctgcagaacattgccacagtagtacagcacagtgaaggaagacctctgagtgtgactgtgatccgcaacggcaagaaagtgcacctggggctgactccaaagcgctgggctgggaagggcctcctgggctgcaatatcattcccttgcaaagatgaccacagctcagaagacaataaaaatgaagcttgtgcctgctttctggactctgatttggtttgaaagcttgccctaagatctttgtttttgctgaaatgagtgtttcggaggctgtgacctctaggtggctgggcttgcagagtctgaagaggttctgttggagcagggccttaatgcagatggaattgcactggtttgtggggagcaactcacagagttgcaggatgtggcttctcatctcttgtgccttgcatcagtttggagtaaggctggagtgtaactcagatttcacttgagacagatttggaggagcatagaatgcttttatgtggtgataacgtggcattccttcttttttgttgtttctctgtgaaattcctcactgaacatcttgtaaaataggataaaaagacctggaacaattttttcttttttttaaattagtagatcacagtcaaggaacgtgcaaatctggcactttgtccttcccatgtgagcacagctgttggaagtcactaaataagatagcatttttggaatgcctaattattttaagttaatgaaatcagcattggggttataactctgtcttttaatgtattgaagtactcttaaattttttatttgctgcagttgattttggggtgtatgaacacttcagggggggttggggtgatcttgtttgtaaggttgtttccagttgaactttgaaattctcatcccaatgaataaaactgagtgatgtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]