GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-23 15:07:26, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_011351402             266 bp    RNA     linear   VRT 18-NOV-2024
DEFINITION  PREDICTED: Narcine bancroftii uncharacterized lncRNA
            (LOC138753746), ncRNA.
ACCESSION   XR_011351402
VERSION     XR_011351402.1
DBLINK      BioProject: PRJNA1181001
KEYWORDS    RefSeq.
SOURCE      Narcine bancroftii (Caribbean electric ray)
  ORGANISM  Narcine bancroftii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes;
            Elasmobranchii; Batoidea; Torpediniformes; Narcinidae; Narcine.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_091469) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_036971445.1-RS_2024_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/13/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..266
                     /organism="Narcine bancroftii"
                     /mol_type="transcribed RNA"
                     /isolate="sNarBan1"
                     /db_xref="taxon:1343680"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Apalachee Bay near Panacea, Florida"
                     /lat_lon="30.037222 N 84.170833 W"
                     /collection_date="2020-10-03"
                     /collected_by="Gavin Naylor"
     gene            1..266
                     /gene="LOC138753746"
                     /note="uncharacterized LOC138753746; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:138753746"
     ncRNA           1..266
                     /ncRNA_class="lncRNA"
                     /gene="LOC138753746"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:138753746"
ORIGIN      
gtctcattaagcacttcgtctagacagagttaaaatgatgagcaaaggcaactatgttaatgtattacacaatcaagaagagattgtattcgatgtgatggggatcctttatgatgatggctgccttcttgaagcagtgtctcacactgatgtcttcaatagacagaacgccagcactggtgctgaatgttacttcagtgtggaatttgctgtgcaccattccaaaattacaatttgtgtacatcaaggataatccaatgaggagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]