GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 20:31:25, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_008797605             313 bp    RNA     linear   INV 18-MAY-2023
DEFINITION  PREDICTED: Ostrea edulis uncharacterized LOC130049079
            (LOC130049079), ncRNA.
ACCESSION   XR_008797605
VERSION     XR_008797605.1
DBLINK      BioProject: PRJNA970818
KEYWORDS    RefSeq.
SOURCE      Ostrea edulis
  ORGANISM  Ostrea edulis
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae;
            Ostrea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_079171) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_947568905.1-RS_2023_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/10/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..313
                     /organism="Ostrea edulis"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:37623"
                     /chromosome="8"
     gene            1..313
                     /gene="LOC130049079"
                     /note="uncharacterized LOC130049079; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:130049079"
     ncRNA           1..313
                     /ncRNA_class="lncRNA"
                     /gene="LOC130049079"
                     /product="uncharacterized LOC130049079"
                     /db_xref="GeneID:130049079"
ORIGIN      
tcttcggagtgtatcgaccaaaaagtaggtcactgtgacctacttttggcatttgacagttatatttatatatttcagtcactaattgacctacaatcatcaaactttgacagttgatgcatcttgagtctacggagtgtgtcgaccaaaaagtaggtcaccttgacctacttttggaattggacggctatatttatatattttcagatactatttgacctacagtcatcaaactttgtcagttgttgggtcttgcatgttcgaagggtttcaaccaaaaagtaggtcaccttgacctacttttggaattgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]