LOCUS       XR_007212523             915 bp    RNA     linear   ROD 19-MAY-2022
DEFINITION  PREDICTED: Perognathus longimembris pacificus Fc epsilon receptor
            Ia (Fcer1a), transcript variant X2, misc_RNA.
ACCESSION   XR_007212523
VERSION     XR_007212523.1
DBLINK      BioProject: PRJNA837248
KEYWORDS    RefSeq.
SOURCE      Perognathus longimembris pacificus (Pacific pocket mouse)
  ORGANISM  Perognathus longimembris pacificus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Castorimorpha; Heteromyidae; Perognathinae; Perognathus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_063171) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Perognathus longimembris pacificus
                                           Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..915
                     /organism="Perognathus longimembris pacificus"
                     /mol_type="transcribed RNA"
                     /isolate="PPM17"
                     /sub_species="pacificus"
                     /db_xref="taxon:214514"
                     /chromosome="11"
                     /sex="male"
                     /cell_line="21356"
                     /cell_type="fibroblast"
                     /tissue_type="trachea"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Santa Margarita"
                     /collection_date="2019"
                     /collected_by="SDZWA"
     gene            1..915
                     /gene="Fcer1a"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:125359267"
     misc_RNA        1..915
                     /gene="Fcer1a"
                     /product="Fc epsilon receptor Ia, transcript variant X2"
                     /db_xref="GeneID:125359267"
ORIGIN      

tggcacataaagctagagaggagatggctactgccagggtatggcctgcactgctgcagatggcttcgctgctcttctctccagacggcatgctggcagccactcagaaagctacagtgactttggagccaccatggaatagaatatttaaaggagacaatgtgactcttatatgtcatgggaaaacctcccttgaagctggcccctttacgtggatccacaatggcaccatttctaaggtgacgacttcacgtttggacatcgtgaatgccaactttgaagacagtgggaaatacaaatgccagatcaatggactttatcaaagcgaatctgtgcacctggaagtgttcagtgattggctgctccttcagtcctctgctgagatggtgagagagggtgagacctttctcatcaggtgtcatggctggaggaactggaatgtctacaaggtgatctactacaaggatgatgtagctttcaagtacatgtaccaaagcccaaacatcaccattaccagtgcctcacttaatgacagtggtacctatcactgtgatggcagagttcggcgcctggaatatcactctgagaggctcaaaattactgtgataaaagcttaccaatccaggttttcctggctccaagttattattccattggcagtggccatgctgtttgctgtggacacagggatattgttctcaacccgggagcagttcaaatcaatcctgaagattcgggagaccagaaaaagtggccaacacaagtccactcctcaaagtagctaatgtcattactaaagaaacagtttgccctagcaatacattacagcctactcaataactttgcaaatgtcaaacatagttcacaatatgcacagagacacccatactcaaagatctacagatctgttcaatt

//