2025-04-22 02:11:41, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_007212523 915 bp RNA linear ROD 19-MAY-2022 DEFINITION PREDICTED: Perognathus longimembris pacificus Fc epsilon receptor Ia (Fcer1a), transcript variant X2, misc_RNA. ACCESSION XR_007212523 VERSION XR_007212523.1 DBLINK BioProject: PRJNA837248 KEYWORDS RefSeq. SOURCE Perognathus longimembris pacificus (Pacific pocket mouse) ORGANISM Perognathus longimembris pacificus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Castorimorpha; Heteromyidae; Perognathinae; Perognathus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_063171) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Perognathus longimembris pacificus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..915 /organism="Perognathus longimembris pacificus" /mol_type="transcribed RNA" /isolate="PPM17" /sub_species="pacificus" /db_xref="taxon:214514" /chromosome="11" /sex="male" /cell_line="21356" /cell_type="fibroblast" /tissue_type="trachea" /dev_stage="adult" /geo_loc_name="USA: Santa Margarita" /collection_date="2019" /collected_by="SDZWA" gene 1..915 /gene="Fcer1a" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:125359267" misc_RNA 1..915 /gene="Fcer1a" /product="Fc epsilon receptor Ia, transcript variant X2" /db_xref="GeneID:125359267" ORIGIN
tggcacataaagctagagaggagatggctactgccagggtatggcctgcactgctgcagatggcttcgctgctcttctctccagacggcatgctggcagccactcagaaagctacagtgactttggagccaccatggaatagaatatttaaaggagacaatgtgactcttatatgtcatgggaaaacctcccttgaagctggcccctttacgtggatccacaatggcaccatttctaaggtgacgacttcacgtttggacatcgtgaatgccaactttgaagacagtgggaaatacaaatgccagatcaatggactttatcaaagcgaatctgtgcacctggaagtgttcagtgattggctgctccttcagtcctctgctgagatggtgagagagggtgagacctttctcatcaggtgtcatggctggaggaactggaatgtctacaaggtgatctactacaaggatgatgtagctttcaagtacatgtaccaaagcccaaacatcaccattaccagtgcctcacttaatgacagtggtacctatcactgtgatggcagagttcggcgcctggaatatcactctgagaggctcaaaattactgtgataaaagcttaccaatccaggttttcctggctccaagttattattccattggcagtggccatgctgtttgctgtggacacagggatattgttctcaacccgggagcagttcaaatcaatcctgaagattcgggagaccagaaaaagtggccaacacaagtccactcctcaaagtagctaatgtcattactaaagaaacagtttgccctagcaatacattacagcctactcaataactttgcaaatgtcaaacatagttcacaatatgcacagagacacccatactcaaagatctacagatctgttcaatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]