LOCUS       XR_006845052             709 bp    RNA     linear   VRT 03-FEB-2022
DEFINITION  PREDICTED: Scatophagus argus Fc receptor, IgE, high affinity I,
            gamma polypeptide like (fcer1gl), transcript variant X1, misc_RNA.
ACCESSION   XR_006845052
VERSION     XR_006845052.1
DBLINK      BioProject: PRJNA776026
KEYWORDS    RefSeq.
SOURCE      Scatophagus argus
  ORGANISM  Scatophagus argus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Scatophagidae; Scatophagus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_058505.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Scatophagus argus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..709
                     /organism="Scatophagus argus"
                     /mol_type="transcribed RNA"
                     /isolate="fScaArg1"
                     /db_xref="taxon:75038"
                     /chromosome="13"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="Singapore"
                     /lat_lon="1.3521 N 103.8198 E"
                     /collection_date="2018-08-06"
                     /collected_by="Byrappa Venkatesh"
     gene            1..709
                     /gene="fcer1gl"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 long SRA read, 6 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 27 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:124069463"
     misc_RNA        1..709
                     /gene="fcer1gl"
                     /product="Fc receptor, IgE, high affinity I, gamma
                     polypeptide like, transcript variant X1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:124069463"
ORIGIN      

cccggacttcctgtcactacttctcagagctcatttcagagggttttcaacagacaacaagagagcgaaaagcgtaccatccatctgaacagaagcctgtttggtaagatggtgcaatcgttgctcttcgctctctttctggcggtcagtcccacctgcaccgaggcctttggagtcatgaacggttgttacatcctggatgggatcctcatcctttacggcgtcattctcactgtcttgtactgcagactcaggatcagtccagccagcaaaaggtctgccaatcaacctgagaagcagcccgcagatggaggcatctatgcgggtctgacttcgcgcagtactgatacctacgagaccttgagaatggacaaaaagcccattgtgtgatggagacggaggataccgagcacagtgctgaatctcttgaagctttatacttttttcctgaggctcatcacaacaccggaagctaacgcatccagctgtctattatgaaaacagtgacgcaaaacaagtttgaaattccctagaaatggctgcagttggatgatgatgacattagcatttattaacctattattatatataacctgttaacatttttctttacattgatcatgctaacattaaatcatgttaaacctgctgctttgacaaaagctgtttcttgcaacaagacaataaaactatatgaataaagccttta

//