2025-10-19 23:59:28, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_069006718 2046 bp mRNA linear VRT 05-OCT-2024 DEFINITION PREDICTED: Aphelocoma coerulescens vimentin (VIM), mRNA. ACCESSION XM_069006718 VERSION XM_069006718.1 DBLINK BioProject: PRJNA1168067 KEYWORDS RefSeq. SOURCE Aphelocoma coerulescens (scrub jay) ORGANISM Aphelocoma coerulescens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Corvoidea; Corvidae; Aphelocoma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_091015) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_041296385.1-RS_2024_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/04/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2046 /organism="Aphelocoma coerulescens" /mol_type="mRNA" /isolate="FSJ_1873_10779" /db_xref="taxon:39617" /chromosome="2" /sex="female" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="USA: Florida, Venus, Archbold Biological Station" /lat_lon="27.18 N 81.35 W" /collection_date="2021-07-13" gene 1..2046 /gene="VIM" /note="vimentin; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:138106307" CDS 79..1458 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_068862819.1" /db_xref="GeneID:138106307" /translation="
MSISTKNSSYRRMFGGSSRPSTGTRYITSSTRYSLGSALRPSSARYVSASPGGMYASKTTSVRLRSSMPPMRLHDSVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFAALNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 100..360 /gene="VIM" /note="Intermediate filament head (DNA binding) region; Region: Filament_head; pfam04732" /db_xref="CDD:461414" misc_feature 361..1287 /gene="VIM" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:459643" polyA_site 2046 /gene="VIM" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cggccaccgcccttcttcgccgcacgccccagtggtcgcgctccgctcccggattacaaagcccgcgccgccgtcgctatgagcatcagcacgaaaaactcctcgtaccgccgcatgttcggcgggagcagccgccccagcaccggcacccgctacatcacgtccagcacccggtactcgctgggcagtgccctgcggcccagcagcgcccggtacgtgtccgcctcgcccggcggcatgtatgccagcaagacgacgtcggtgcggctgcggagcagcatgccgcccatgcggctccacgactccgtagacttctccctggccgacgccatcaacacggagtttaaggcgaaccgcactaatgagaaggttgagctgcaggagcttaatgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcaaaacaagatcctgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggtgacctctacgaggaggagatgcgggagctgcggcgacaggtggaccagctcaccaacgacaaggcacgcgtggaagtggagcgggacaacctcgccgacgacatcatgcggctgcgggagaagttgcaagaggagatgcttcagagggaggaggccgagaacaccctgcagtctttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccctgcaagaggagattgtcttcttgaagaagcttcatgatgaggaaatccgagaattgcaggcccaactccaggaacagcacatccagattgatatggatgtttctaagcctgatcttactgctgccctgcgtgatgttcgccaacagtatgagagtgttgctgctaagaatctccaggaagctgaagaatggtacaagtccaaatttgcagatctctctgaagctgctaacaggaacaacgatgccctgcgccaggccaagcaggaagccaatgagtaccgcagacagatccagtctctcacctgtgaagtcgatgctcttaagggaagcaatgagtccctggagcgccaaatgcgtgaaatggaggagaactttgctgttgaagctgctaactaccaagacactattggccgtctgcaggatgagatccagaacatgaaggaagagatggctcgccatctccgcgagtaccaggacctgctgaatgtaaagatggcccttgatattgagattgccacctacagaaaactgctggagggtgaagagagcaggattaacatgcctattccaacctttgctgctttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagagaacacttctaattaagaccgtcgaaactagagatggacaggttattaatgaaacttcccagcatcatgatgacttggagtaaagctgaagtgatgatgcatacttactaaaggagaaattcttaccagcaagattgaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagatgattatgctaggaaataggtcttagatcttacaaactgactccctctgaaggattagagtttacaatggagcctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttgttaacttcatgagtttctggaaagccataacaacataatgctggaattgttatacggttgacatctctagtactggctgtgtggaatgctgttttttcagtttaactagataaactgtcttactcactgcttaggttttggaaccaattaaaatggattataactggcagatgcataatgtattatgatatttcttatcacttgaataaaatacttcaagctaataaaaattaatcttgcttcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]