GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-23 16:26:31, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_068673829            1807 bp    mRNA    linear   VRT 22-SEP-2024
DEFINITION  PREDICTED: Anas acuta vimentin (VIM), mRNA.
ACCESSION   XM_068673829
VERSION     XM_068673829.1
DBLINK      BioProject: PRJNA1122813
KEYWORDS    RefSeq.
SOURCE      Anas acuta (northern pintail)
  ORGANISM  Anas acuta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes;
            Anatidae; Anatinae; Anas.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_088980) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963932015.1-RS_2024_09
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/19/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1807
                     /organism="Anas acuta"
                     /mol_type="mRNA"
                     /db_xref="taxon:28680"
                     /chromosome="2"
     gene            1..1807
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 2 Proteins"
                     /db_xref="GeneID:137852266"
     CDS             101..1483
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_068529930.1"
                     /db_xref="GeneID:137852266"
                     /translation="
MSMSSKNSSYRRMFGGGSRPSTSSRYVVSSSSRYSLGSSLRPSSARFVSASPGGIYATKATSVRLRSSMPPMRLHDAVDFTLADAINSEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDITRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     polyA_site      1807
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gggggccgccgcccttctcctcagagcctcgccgcgcctcagctccccgccggattacaaagcccgcttcgtctccttctcctccttctccgccgccaccatgagcatgagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcacgtcgagccgctacgtggtgagcagcagcagccgctactcgctgggcagctcgctgcgccccagctccgcacgcttcgtctccgcctcgcccggcggcatctacgccaccaaggccacctcggtgcggctgcggagcagcatgccccccatgcggctccacgacgccgtggacttcacgctggccgacgccatcaactcggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggcgacctgtacgaggaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcgagggtggaggtggagcgggacaacctggccgacgacatcacgaggctgagggagaagttgcaggaggagatgctgcagcgggaggaggcggagaacaccctgcagtccttcaggcaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgagaactgcaggcccaactccaggaacagcacatccagatcgatatggatgtttccaagcctgatcttactgctgccctgcgtgatgttcgccaacagtacgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaacaggaacaatgatgccctgcgtcaggccaaacaagaagctaatgaataccgcagacagattcagtctctcacctgcgaagttgatgcccttaaaggaagcaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctcttgaagctgctaactaccaagacactattggccgtctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagaggacacttctaattaagactgtggaaactagagatggacaggttattaatgaaacttcccagcaccatgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggtttaaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]